Understanding the pro- & anti-inflammatory cytokine profile in Japanese encephalitis & their implications in survival outcome

Materials & Methods

This cross-sectional study was conducted at the department of Microbiology, Gauhati Medical College, Guwahati, Assam, after obtaining the ethical clearance from the Institutional Ethics Committee.

Study design

A descriptive study was carried out in a hospital setting from January 2022 to August 2023. The research work was carried out at the State Level Virus Research and Diagnosis Laboratory (SVRDL) and Multidisciplinary Research Unit (MRU) of the institute.

Sample size

The calculated sample size was 122, based on an estimated true proportion rate of 0.39 at a 95% confidence level, assuming a desired precision rate of nine per cent. This calculation utilised the formula n=(Z² × P × (1 - P))/e², where the Z-score, which is the critical value from the standard normal distribution for the desired confidence level [e.g., 1.96 for a 95% confidence level (CI)], was used alongside the population proportion (P) and the margin of error (e) to define the precision of the estimate¹⁶.

Criteria for case enrolment

As per the National Vector Born Disease Control Programme (NVBDCP) and the World Health Organisation (WHO) case definition, acute encephalitis syndrome (AES) was defined as congregation in a person of any age, at any time of year the symptoms of acute onset of fever (>38°C) in the last seven days with one or more of the following: a change in mental status (including symptoms such as confusion, disorientation, coma or inability to talk), and/or new onset of seizures (excluding simple febrile seizures)¹⁷. The samples were collected from the participants before the initiation of the treatment protocol on the day of admission. The participants testing positive for pyogenic meningitis or other bacterial infections were excluded from the study.

The cerebrospinal fluid (CSF) and serum samples from 58 symptomatic participants, as well as CSF samples from 14 symptomatic participants, were collected to confirm of JE. Whole blood samples were collected from all 72 laboratory-confirmed JE cases and from 50 healthy controls. For analysis of the cytokine gene expression, whole blood from 50 laboratory-confirmed cases of JE and 50 age and sex-matched healthy controls were considered.

Detection of Japanese Encephalitis Virus (JEV)

For laboratory confirmation of JE, IgM antibodies specific to JEV were identified using IgM antibody capture ELISA kits sourced from the National Institute of Virology (NIV) in Pune, India, followed by Real-Time PCR for JEV according to established protocols as per NVBDCP guideline (2009), which states that the presence of JE virus-specific IgM antibody in a single sample of serum and/or cerebrospinal fluid (CSF), as detected by an IgM capture ELISA specifically for JE virus or nucleic acid detection by PCR is a case of laboratory-confirmed JE¹⁷.The serum and/or CSF samples positive for JEV IgM ELISA were further subjected to JEV PCR. The Viral nucleic acid was extracted using QIAamp Viral RNA Mini kit (Qiagen, Hilden, Germany). cDNA was prepared using Verso cDNA synthesis kit (Thermo Scientific, Waltham, MA, USA). Samples were further screened by SYBR Green real-time PCR (Bio-Rad Laboratories Inc., 2000 Alfred Nobel Drive, Hercules, CA, USA) for JEV. The primers were designed at the Indian Institute of Technology, Guwahati, Assam, targeting the E gene and NS1 gene of JEV. The following two sets of primers were used qJEV E Forward primer (GCCCCAACTTGCGCTGAATA), qJEV E Reverse primer (GGGAAGGGAAGCATTGACAC), qJEV NS1 Forward primer (GCTGGTACGGAATGGAAATC), and qJEV NS1 Reverse primer (CTCGCCAAATC AGTGTAAG).

Cross-reactivity of the samples was excluded by subjecting the samples to Dengue NS1 antigen ELISA (InBios), Dengue IgM ELISA (NIV Pune), Chikungunya IgM ELISA (InBios) and IgM ELISA for West Nile virus (InBios). The patients who were negative for Dengue virus, Chikungunya virus, and West Nile virus were included in the study for cytokine analysis. The control samples were also pre-screened for the presence of IgM antibodies against flaviviruses such as dengue, chikungunya, and West Nile virus.

Estimation of pro-inflammatory and anti-inflammatory cytokine levels in JE patients

The pro-inflammatory cytokines GM-CSF, IFN-γ, TNF-α, IL-2, IL-12 (P70) and anti-inflammatory cytokines IL-4, IL-5, IL-10, IL-13 were analysed in the Multiplex Bead Based Cytokine Platform Assay (Bio-Plex 200, Bio-Rad, USA) using the Bio-Plex Pro Human Cytokine Th1/Th2 Panel 9-Plex KIT (Bio- Rad, USA) following manufacturer’s guidelines. The limit of detection for various cytokines (Assay sensitivity) was IL-2: 0.75 pg/ml, IL-4: 0.09 pg/ml, IL-5: 0.86 pg/ml, IL-10: 0.69 pg/ml, IL-12 (p70): 0.78 pg/ml, IL-13: 0.22 pg/ml, GM-CSF: 0.19 pg/ml, IFN-γ: 1.05 pg/ml, TNF-α: 1.13 pg/ml.

Results

The age of the study participants ranged from 4 to 65 yr, with a median age (± standard deviation) of 25±24.9 yr. Of the 72 study participants, 45 (62.5%) were male, and 27 (37.5%) were female, with a male-to-female ratio of 1.6:1. The average duration of the illness till sample collection was 5±2.23 days. The predominant clinical symptoms included fever (100%), headache (48.6%), change in mental status (61.1%), neck rigidity (54.1%), unconsciousness (20.8%), paralysis (5.6%), and altered sensorium (1.4%). We performed correlation analyses between the cytokine profile and sex, as well as different age groups. However, there was no significant association observed between these factors and cytokine profile. As all the cases presented with severe forms of disease as per WHO criteria, further subgrouping was not done according to the severity of the disease²⁶.

Pro-inflammatory and anti-inflammatory cytokine levels in JE patients

The result of the comparative analysis of cytokine level in JE positive and healthy control samples were analysed by Mann-Whitney U test and are presented in figure. The current study revealed that the levels of cytokines in individuals with JE were significantly higher compared to that in healthy controls: GM-CSF (73.03 vs. 44.90; P<0.0001), IFN-γ (69.28 vs. 32.32; P<0.0001), IL-2 (74.42 vs. 42.90; P<0.0001), IL-5 (69.54 vs. 47.84; P=0.0007), IL-10 (66.67 vs. 41.23; P<0.0001), IL-12(64.30 vs. 42.31; P=0.0003) and TNF-α (78.49 vs. 32.77; P<0.0001). However, IL-4 level (46.17 vs. 87.42; P<0.0001) was found to be significantly lower in JE group as compared to that in healthy control. On the contrary, the lower level of IL-13 (55.81 vs. 61.53; P=0.3521) in the JE group compared to healthy control was statistically insignificant.

Close

Figure.

Comparative analysis of cytokine level in JE positive and healthy control samples. The plasma concentrations GM-CSF, IL-2, IL-5, IL-10, IL-12, IL-13, TNF-α, IFN-γ and IL-4 in JE and healthy control. Results are presented as mean±standard error of mean (SEM). JE vs. healthy control: P^***<0.001, ^****<0.0001.

Export to PPT

Discussion

In the current study, in JE patients, pro-inflammatory cytokines such as GM-CSF, IFN-γ, IL-2, IL-12, and TNF-α were significantly elevated compared to healthy controls. Conversely, anti-inflammatory cytokines IL-5 and IL-10 were also higher in JE patients, while IL-4 levels were notably lower. The excessive production of these cytokines have been recorded to be linked to poorer outcomes in JE cases¹⁴. Interestingly, cytokine inhibitors that target interferon regulators and TNF-α receptors are potential candidates for adjunctive therapy in JE animal model^27,28. Preclinical studies documented increased levels of IFN-γ, TNF-α, IL-6, IL-1β, IL-18, and IL-12 in response to JEV infection^4,6,29-33. Following JEV infection, host cells release type-1 IFN, TNF-α, and IFN-γ, which trigger inflammatory responses that inhibit viral replication. Furthermore, upon adhering to natural killer (NK) cells, IFN-α and IFN-β initiate the lytic activity that eliminates the JEV-infected cells. Notably, IL-12 is released early during infection to initiate antiviral activity, followed by secretion of IFN-γ, which stimulates MHC-II molecule-expressing brain macrophages, which aids in the generation of additional cytokines that prevent viral replication³⁴. However, prolonged production of IFN-γ can exacerbate neuroinflammation and disruption of BBB and lead to tissue damage, potentially resulting in neurologic complications such as seizures and cognitive impairment³⁵.

The current study reported a high concentration of IL-12 in JE as compared to healthy controls. IL-12 is being explored as a therapeutic target for managing the neuroinflammatory response in JE due to its promising role in enhancing protective immune responses against viral infections. It promotes Th1 responses, activates NK cells, and boosts cytotoxic T-cell activity, which is crucial for an effective immune response against JEV. Targeting IL-12 signalling pathways may offer promising strategies for controlling neuroinflammation and improving outcomes in JE³⁶.

While IL-2 is crucial for coordinating the immune response to JEV, its excessive production can lead to neuroinflammation and CNS damage. Modulating IL-2 activity or blocking its signalling pathways may help reduce neuroinflammation associated with JEV infection³⁵. We report here elevated levels of IL-2 in JE patients compared to healthy controls. Additionally, increased levels of IL-5 were found in JE patients in our study. IL-5, typically associated with eosinophil activation and allergic reactions, may also be involved in neuroinflammation by impacting the recruitment and activation of immune cells within the CNS³⁶.

GM-CSF activates and recruits CNS immune cells, specifically microglia, as well as infiltrating monocytes and macrophages³⁷, and a higher level of it was identified in this study in the JE group compared to the healthy control. GM-CSF is also known to promote microglia and macrophages to produce pro-inflammatory cytokines and chemokines, facilitating the activation and recruitment of additional immune cells alongside the secretion of TNF-α, IL-1β, and IL-6³⁸.

In the current study, IL-13 level was found to be lower in JE patients than in the control. While its role in neuroinflammation related to JE is not well-studied, some research suggests that IL-13 may enhance BBB permeability, allowing for increased immune cell infiltration into the central nervous system (CNS). Conversely, other studies indicate that IL-13 can protect the BBB by reducing endothelial cell activation and maintaining its function³⁹. Following JE infection, IL-13 may contribute to neurodegeneration but can also limit neuronal damage in the CNS, suggesting that elevated IL-13 levels may reflect a protective response to JE infection.

The present study found that expression of IL-12, IL-10, and TNF-α was upregulated, while IL-4 and IL-13 were downregulated in JE patients compared to healthy controls. There is limited data on the implications of cytokines in JE, and the mechanisms of cytokine production remain unclear. The decreased expression of IL-4 may be linked to the recovery phase of JE, as IL-4 plays a significant role in preventing neuronal damage by inhibiting activated microglia from producing TNF-α and nitric oxide^40,41.

The naïve CD4+ T cells develop into Th2 cells in response to IL-4, which again releases cytokines with anti-inflammatory properties such as IL-4, IL-5, and IL-10⁴². As stated by Saxena et al⁴³, these cytokines aid in controlling immune responses and reducing inflammation IL-4 may prevent immune cells and inflammatory mediators from infiltrating the CNS during neuroinflammatory diseases by maintaining the BBB integrity^44,45.

The present study documented an upregulated expression of the anti-inflammatory cytokine IL-10, potentially indicating increased activity of anti-inflammatory Treg cells and highlighting IL-10’s protective role after immune insult. A recent study emphasised the protective role of IL-10 in tick-borne encephalitis, noting that IL-10 knockout mice exhibited higher mortality rates after infection with the Oshima strain^46,47.

Comparable cytokine levels were previously reported in flavivirus infections like Dengue. Puc et al⁴⁸ (2021) noted elevated levels of GM-CSF, IL-1β, IL-2, IL-6, IL-8, IL-10, IL-12p70, IL-17A, IFN-γ, and TNF, alongside decreased IL-4 levels. In contrast, our study found increased GM-CSF, IFN-γ, IL-2, IL-5, IL-10, IL-12, and TNF-α in JE, with lower IL-4 and IL-13 levels. Bhatt et al⁴⁹ examined cytokine profiles in Dengue but did not observe significant changes in IL-5 levels.

In this study, we observed significantly upregulated expression of IL-12, IL-10, and TNF-α in the JE group compared to healthy controls, alongside significantly downregulated expression of IL-4 and IL-13 levels. Similar findings were reported in Dengue infections^50-52.

In conclusion, the differential expression of cytokine regulators in JE infection indicates potential areas for further research in the future. An in-depth understanding of the dysregulated immune responses underlying the pathogenesis of JE disease may help identify therapeutic windows. Given the considerable morbidity and mortality recorded annually in the country, as well as the low uptake of JE vaccines in many communities, continued research efforts in this direction are necessary.