Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
View/Download PDF

Translate this page into:

Practice: Original Article
159 (
2
); 180-192
doi:
10.4103/ijmr.ijmr_3530_21

Molecular detection of Orientia tsutsugamushi in ectoparasites & their small mammal hosts captured from scrub typhus endemic areas in Madurai district, India

Division of Vector Borne Zoonotic Diseases, ICMR-Vector Control Research Centre Field Station, Madurai, Tamil Nadu, India
DBT -BIF Centre, Lady Doak College, Madurai, Tamil Nadu, India
ICMR-Vector Control Research Centre, Puducherry, India

For correspondence: Dr P. Philip Samuel, Division of Vector Borne Zoonotic Diseases, ICMR-Vector Control Research Centre Field Station, Madurai 625 002, Tamil Nadu, India e-mail: philipsamuelpaulraj@gmail.com

Licence
This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.
Disclaimer:
This article was originally published by Wolters Kluwer - Medknow and was migrated to Scientific Scholar after the change of Publisher.

Abstract

Background & objectives:

Scrub typhus, caused by Orientia tsutsugamushi present in small mammals harbouring the ectoparasites. A study was undertaken to detect the pathogen present in small mammals and its ectoparasites in the scrub typhus-reported areas.

Methods:

The small mammals (rodents/shrews) and its ectoparasites were screened for O. tsutsugamushi using nested PCR amplification of the groEL gene. Small mammals were collected by trapping and screened for ectoparasites (mites, ticks and fleas) by combing method.

Results:

All the chigger mites collected were tested negative for O. tsutsugamushi. Interestingly, adult non-trombiculid mites (Oribatida sp., Dermanyssus gallinae), fleas (Xenopsylla astia, X. cheopis, Ctenophalides felis and Ctenophalides sp.) and ticks (Rhipicephalus sanguineus, R. haemaphysaloides) screened were found to be positive for O. tsutsugamushi, which the authors believe is the first report on these species globally. Bandicota bengalensis with O. tsutsugamushi infection is reported for the first time in India. The O. tsutsugamushi groEL sequences from the positive samples were similar to the reference strains, Karp and Ikeda and phylogenetically clustered in clade IV with less evolutionary divergence. The blood samples of Rattus rattus, Suncus murinus and B. bengalensis collected from this area were tested positive for O. tsutsugamushi; interestingly, the sequence similarity was much pronounced with their ectoparasites indicating the transmission of the pathogen to host or vice versa.

Interpretation & conclusions:

The outcome of the present investigations widened our scope on the pathogens present in ectoparasites and rodents/shrews from this area. This will help to formulate the required vector control methods to combat zoonotic diseases.

Keywords

Fleas
non-trombiculid mites
Orientia tsutsugamushi
rodents/shrew
scrub typhus
ticks

Geographically confined areas of Asia-Pacific region consisting of south and south-east Asia, northern Australia, Pacific and Indian ocean islands are endemic for scrub typhus infection1. There were more than one million scrub typhus cases annually in Asia with high mortality rate as reported in 20152. Central nervous system infection has high mortality rate34. The emergence of scrub typhus has been reported from various parts of the world, including Chile and Africa5. Re-emergence of scrub typhus in various States of India with diverse ecological parameters has been reported6. Scrub typhus infection is presented as non-specific flu-like symptoms, including fever, cough, rash, myalgia, vomiting, nausea, eschar at the site of bite, abdominal pain and generalized lymphadenopathy. About one-third of infections proceed to multi-organ failure, including renal, myocardial, septic shock, meningoencephalitis and pulmonary disturbances6. It is also reported that diagnosis is complicated as eschar may not manifest in all cases4. Case fatality rate (CFR) of scrub typhus differs across various countries and regions. The CFR can increase to 30-70 per cent if treatment is not initiated promptly12.

Orientia tsutsugamushi (formerly Rickettsia tsutsugamushi78), the causative agent of scrub typhus infection, is transmitted to mammalian hosts (including humans) by the larvae stage of Leptotrombidium mites, also called chiggers9 which serve as its primary reservoirs. The infected larval mite feeds on vertebrates, including humans, rodents, and other small mammals. The nymph and adult mites reside in the soil. Rodents infected with O. tsutsugamushi can maintain the infection for a greater time period5.

The diagnosis of scrub typhus in humans is based on the patient’s history (e.g., travel, work including farming) and clinical features (like the presence of eschar) and confirmation by the standard laboratory methods, including immunofluorescence assay, enzyme-linked immunosorbent assay and Polymerase Chain Reaction (PCR) (direct, nested and real-time)10. The nested PCR-based method is more reliable and easier for diagnosis. As other Rickettsia sp., can also cause spotted fever, typhus fever which can mimic scrub typhus-like infection; it is essential to differentiate the infection at the earliest to avoid misdiagnosis and treatment11. GroEL chaperonin, (60 kDa heat-shock protein), is typically used for diagnostics, as this gene is highly conserved in O. tsutsugamushi strains. GroEL gene sequences are known to have higher degree of divergence across the rickettsiae; and have been shown to facilitate the rapid diagnosis of rickettsial diseases as well as differentiate between these as against other acute febrile diseases1213.

So far only a few reports are available on the prevalence of O. tsutsugamushi in chigger mites on domestic rodents/shrew1415161718 thus it is important to monitor small animals, including rodents and shrews, in the transmission of scrub typhus. Recently, we have reported the presence of trombiculid mites, which are predominant vectors for O. tsutsugamushi in domestic rodents in Madurai1920. In continuation of the same, in the present study we undertook to detect O. tsutsugamushi by nested PCR based on the groEL gene expression in mites from Acari and fleas from ectoparasites collected on domestic rodents, shrews, dogs and cats in Tamil Nadu. This study (i) helps in understanding the presence of scrub typhus pathogens in both vector and vertebrate host, (ii) it also helps to identify potential high-risk areas for scrub typhus infection.

Material & Methods

Study sites: Nine study sites were selected within Madurai district and grouped into urban (Usilampattii, Thirumangalam and B.B. Kulam), sub-urban (Keelaiyur, Sholavandan and Peraiyur), and rural (Chatrapatti, Katchiakatti and Vadapalanji) habitats. The Madurai district is situated in southern part of Tamil Nadu State, lies between 9°33’30” N to 10°18’50” N Latitude, 77°29’10” E to 78°28’45” E Longitude with an area spanning across 3710 km2 (https://madurai.nic.in/district-profile/). Previously Varghese et al21 reported scrub typhus infection in the areas near Madurai district. In order to understand the prevalence of O. tsutsugamushi in Madurai district, in this study entomological and small mammal surveillance was undertaken. The study was carried out between July 2017 to June 2018 after seeking approval by the Institutional Animal Ethics Committee of Madurai Medical College, Madurai, Tamil Nadu.

Trapping of rodents and shrews: Small mammals were trapped over a period of one year using 360 Sherman traps for each habitat (urban, semi urban and rural ). A total of 1080 traps were placed in all habitats i.e., 324 traps were placed indoors (urban-64, sub urban -103, and rural-157) and 756 traps were placed outdoors (urban-296, sub urban-257, and rural-203) including indoors (urban -64, sub-urban -103 and rural -157) and outdoors. Traps were kept at indoor and outdoor households in residential areas before dusk (5-6 PM) hours and withdrawn after dawn time (6-7 AM), i.e. next morning. The rodents/shrews were attracted by eatables (potato chips/wheel chips) fried in coconut oil and placed within the Sherman traps22. The trapped rodents/shrews were brought safely to the laboratory by keeping them inside separate cloth bags.

Processing of small mammals: The trapped rodents/shrews were euthanized with thiopentone sodium injection (60 mg/kg intravenously). The euthanized rodent and shrews were then taken out of the trap1520. A cardiac puncture was performed to collect 1-2 ml blood using the appropriate procedure in ethylenediamine tetraacetic acid tubes and stored at −20°C until further use15. Euthanized rodents/shrews were identified up to species level using external morphological characteristic features2324.

Collection of chigger mites from rodents/shrews: Trombiculid mites were collected using a fine brush from the rodents and shrews. Ear pinna and femur were the major sites for the collection of mites. The collected mites were stored in 70 per cent ethanol2022.

Tick collection from rodents/shrews: Ticks were collected from the rodents/shrews using curved tweezers from the body areas such as the head, ear, face and legs, which are major sites for tick inhabitation. The ticks were grabbed using a curved tweezer as close as possible to the skin surface, then gently pulling away from the skin without twisting at a 45° angle. The collected ticks were transferred and stored in vials containing 70 per cent ethanol.

Collection of fleas from cat and dog: A total of 100 households were selected at random from rural, sub-urban and urban habitats, for testing the presence of fleas on cats and dogs. About 20 dogs and cats were tested at every habitat. Fleas were manually collected in a white sheet/white enamel tray by combing the body hair of the host. The fleas were then immediately transferred into vials containing 70 per cent ethanol with a pair of forceps.

Identification, dissection and preservation of chiggers: Each chigger mite was placed in a drop of 70 per cent ethanol solution on a slide. Under a dissection microscope, the exoskeleton of the mite was punctured, the idiosoma and internal tissue contents including haemolymph were squeezed out using angled or notched forceps. The internal contents of the chigger in ethanol were thoroughly broken into fragments using a minute pin. A tiny amount of the internal content suspension was transferred to an Eppendorf tube using a micropipette. The tube was kept in a deep freezer (−20°C) until tested. A new sterile dissecting needle was used for each chigger mites.

The exoskeleton of the chigger, which remained mostly intact, was transferred to lactophenol solution (50 ml lactic acid, 25 ml phenol and 25 ml distilled water) for clearing the specimen. All mite specimens were then mounted on separate slides with Hoyer’s medium and identified upto species level under Nikon ECLIPSE (E200) microscope2526272829303132. These mounted slides and other preserved specimen vials were deposited in National Mite Museum, under the Unit of Vector-Borne and Zoonotic Diseases, ICMR-Vector Control Research Centre Field Station Madurai, Tamil Nadu.

Chigger index and chigger infestation rate: Chigger index (CI) was calculated by dividing the total number of chigger mites collected by the total number of hosts examined. Similarly, the chigger infestation rate (CIR) was calculated as the percentage of the total number of chigger mites collected divided by a total number of hosts collected with chigger mites22.

Molecular detection of Orientia tsutsugamushi in ectoparasites, rodents and shrew DNA extraction of ectoparasites and small mammals: The internal suspension content (see above) collected from species-wise pooled chigger (10-15 Nos.), adult mites, ticks, fleas and individual sera samples of rodents and shrews were used for DNA extraction (Table I). DNA was extracted using a QIAmp blood and tissue mini kit (Qiagen, Hilden, Germany) as per the manufacturer’s instructions. The DNA was then stored at 4°C and used as templates for PCR and stored at −20°C for later.

Table I Number of mammals infested with ectoparasites, Tamil Nadu, India
Mammalian species Area, number of infested/number of mammals (%) All habitats χ2 P
Urban Sub-urban Rural
R. rattus 7/24 (29.17) 9/30 (30) 15/41 (36.59) 31/95 (32.63) 0.5171 >0.05
R. norvegicus 1/1 (100) 1/1 (100) 1/1 (100) 3/3 (100) - -
M. musculus 0/4 (0) 0/5 (0) 0/3 (0) 0/12 (0) - -
S. murinus 3/5 (60) 7/13 (53.85) 7/14 (50) 17/32 (53.13) 0.1525 >0.05
B. bengalensis 1/1 (100) 2/2 (100) 2/3 (66.67) 5/6 (83.33) - -
T. indica 0 0 1/3 (33.33) 1/3 (33.33) - -
C. familiaris (domestic dog) 5/42 (11.9) 8/51 (15.69) 18/60 (30) 31/153 (20.26) 5.9983 <0.05*
F. catus (domestic cat) 1/9 (11.11) 2/6 (33.33) 3/11 (27.27) 6/26 (23.08) - -
Total 18/86 (20.93) 29/108 (26.85) 47/136 (34.56) 94/330 (28.48) 5.0138 >0.05

*P significant at 95% CI. R. rattus, Rattus rattus; R. norvegicus, Rattus norvegicus; M. musculus, Mus musculus; S. murinus, Suncus murinus; B. bengalensis, Bandicota bengalensis; T. indica, Tatera indica; C. familiaris, Canis familiaris; F. catus, Felis catus; CI, confidence interval

Nested PCR amplification for Rickettsia and Orientia tsutsugamushi identification: The initial primer used for the first PCR was based on the groEL gene sequence and target agents of the spotted fever, typhus group of rickettsiae and O. tsutsugamushi. The primers were Gro1: (5’-AAGAAGGACGTGATAAC-3’; position from 603-618 bp); Gro2: (5’-ACTTCACGTAGCACC-3’; position from 1251-1238)33. Thirty microliter of reaction mixture contained 15 µl Taq 2X Master Mix red (Ampliqon), 0.3 µl of each primer (Gro1 and Gro2), 5 µl of DNA template and 9.4 µl of distilled water. PCR reactions were performed in Thermal cycler ABI PCR (Applied Biosystems, USA). The nested PCR used two pairs of inner primers33 in a single reaction. The first pairs of nested primers (SF1 and SR2) target spotted fever and typhus group of rickettsia (217 bp segment), while second pairs of inner primers (TF1 and TR2) target O. tsutsugamushi (364 bp segment) (Supplementary Table I). The 30 µl nested PCR reaction mixture contains 10 µl Taq 2x Master Mix red (Ampliqon), 0.3 µl of each primer (TF1, TR2, SF1 and SR2), 3 µl of first-round products as a template and 15.8 µl of distilled water. Nested PCR reactions were followed by an initial denaturation step at 95°C for two minutes and 40 cycles of denaturation at 95°C for 35 seconds, annealing at 55°C for 35 seconds and 72°C for 35 seconds and final extension at 72°C for five minutes.

Supplementary Table I Nested primers used for PCR amplification
Gene Sequence 5’- 3’(FP) Source
SF1 GATAGAAGAAAAGCAATGATG 13, 33
SR2 CAGCTATTTGAGAGATTAATTTG 13, 33
TF1 ATATATCACAGTACTTTGCAAC 13, 33
TR2 GTTCCTAACTTAGATGTATCAT 13, 33

Source: Ref 13, 33

Electrophoresis and sequencing: PCR products subjected to electrophoresis at 90 V for 60 min on two per cent agarose gel with 0.5 µg/ml ethidium bromide and visualized on gel documentation system (Bio-Rad). Further, the PCR products were gel purified (Invitrogen, USA) and Sanger sequenced bidirectionally (Genurem Biosciences, Tamil Nadu). The obtained sequences were assembled (DNASTAR) and submitted to NCBI.

Phylogenetic analysis: Gene alignment was done along with reference sequences from GenBank by Clustal Omega and the phylogenetic analysis was performed using the maximum likelihood (ML) model in Randomized Axelerated ML (RAxML)34. A general time-reversible model of nucleotide substitution35 with a gamma correction for among-site rate variation and an estimated proportion of invariant sites was used. Internal nodes were statistically supported through boot strapping with 1000 replicates. The genetic distance (p) within and between groups was calculated using MEGA 7.036.

Statistical analysis: The Chi-square test was performed using SPSS version 25 (IBM Corp; NY, USA).

Results

During the 12 months (July 2017-June 2018) study period, 330 animals from three habitats comprising Rattus rattus (95), R. norvegicus (3), Mus musculus (12), Suncus murinus (32), Bandicota bengalensis (6), Tatera indica (3), Canis familiaris (domestic dog, 153) and Felis catus (cat, 26) were screened for ectoparasites infestation. All animals with the exception of T. indica were trapped in all habitats; interestingly, T. indica was trapped only in rural sites. Among the three habitats, individual genus wise, there was no significant difference between Rattus rattus, (χ2=0.5171, df-2, P>0.05) and Suncus murinus, (χ2=0.1525, df-2, P >0.05 with the exception of C. familaris (χ2=5.9983, df-2, P <0.05, n=330) (Table I).

A total of 3860 ectoparasites (Table II) were collected from 330 animals, where 2741 (71%) ectoparasites were morphologically identified (Table III). Interestingly, majority of the ectoparasites, including chigger mites (3151/3219-97.8%), adult mites (6/6-100%), ticks (10/10-100%) and fleas (515/626-82.2%) were obtained from outdoor rural habitat (Table II). Among the identified 2741 ectoparasites from animal hosts, 2099 were chigger mites (belonging to L. deliense, L. indicum, L. keukenschrijveri, L. rajesthanensis, Schoengatiella ligula, Schoengastia sp., Neotrombicula microti, Microtrombicula sp., and Trombicula hypodermata), six were adult mites (belonging to Oribatida sp. and D. gallinae), 626 were fleas (belonging to X. astia, X. cheopis, C. felis and Ctenophalides sp.) and 10 were ticks (belonging to Rhipicephalus sanguineus and Rhipicephalus haemaphysaloides) (Tables II and III). Among 151 trapped rodents/shrews, 57 (37.75%) rodents/shrews were positive for trombiculid mites. M. musculus did not harbour trombiculid mite (Table III).

Table II O. tsutsugamushi from all positive hosts collected indoors and outdoors in all three habitats
Habitat Indoor Outdoor All
Urban Sub-urban Rural Total Urban Sub-urban Rural Total Urban Sub-urban Rural Total
Hosts examined
Rodents/shrews 4 7 14 25 31 44 51 126 35 51 65 151
Cat and dogs 15 18 22 55 36 39 49 124 51 57 71 179
Total 19 25 36 80 67 83 100 250 86 108 136 330
Host positive to ectoparasites
Rodents/shrews 1 2 3 6 12 17 22 51 13 19 25 57
Dogs 0 1 2 3 5 7 16 28 5 8 18 31
Cats 0 0 0 0 1 2 3 6 1 2 3 6
Total 1 2 3 6 18 27 43 88 19 29 46 94
Number of ectoparasites collected
Chiggers 0 16 52 68 785 998 1368 3151 785 1014 1420 3219
Adult mites 0 0 0 0 0 0 6 6 0 0 5 6
Ticks 0 0 0 0 0 0 10 10 0 0 10 10
Fleas 0 36 75 111 60 156 299 515 60 192 374 626
Total 0 52 127 179 845 1154 1682 3681 845 1206 1809 3860
Number of ectoparasites tested for O. tsutsugamushi
Chiggers
Tested 0 8 10 18 416 640 1025 2081 416 648 1035 2099
Positive 0 0 0 0 0 0 0 0 0 0 0 0
Adult mites
Tested 0 0 0 0 0 0 3 3 0 0 3 3
Positive 0 0 0 0 0 0 2 2 0 0 2 2
Ticks
Tested 0 0 0 0 0 0 5 5 0 0 5 5
Positive 0 0 0 0 0 0 3 3 0 0 3 3
Fleas
Tested 0 3 4 7 5 8 15 28 5 11 19 35
Positive 0 0 0 0 1 1 2 4 1 1 2 4
Total
Tested 0 11 14 25 421 648 1053 2122 421 659 1067 2147
Positive 0 0 0 0 1 1 7 9 1 1 7 9

O. tsutsugamushi, Orientia tsutsugamushi

Table III The number of ectoparasites per animal hosts, Tamil Nadu, India
Species Animal hosts (ectoparasites index) Total (n=330)
R. rattus (n=95) R. norvegicus (n=3) M. musculus (n=12) S. murinus (n=32) B. bengalensis (n=6) T. indica (n=3) Dog (n=153) Cat (n=26)
L. deliense 633 (6.66) 19 (6.33) 0 630 (19.69) 58 (9.67) 42 (14) 0 0 1382 (4.19)
L. keukenschrijveri 33 (0.35) 0 0 20 (0.63) 5 (0.83) 0 0 0 58 (0.18)
L. indicum 140 (1.47) 3 (1) 0 80 (2.5) 0 6 (2) 0 0 229 (0.69)
L. rajesthanensis 31 (0.33) 2 (0.67) 0 53 (1.66) 9 (1.5) 0 0 0 95 (0.29)
S. ligula 86 (0.91) 0 0 151 (4.72) 6 (1) 24 (8) 0 0 267 (0.81)
Schoengastia sp. 3 (0.03) 0 0 6 (0.19) 0 0 0 0 9 (0.03)
Microtrombicula sp. 3 (0.03) 0 0 11 (0.34) 0 0 0 0 14 (0.04)
N. microti 0 0 0 4 (0.13) 0 3 (1) 0 0 7 (0.02)
T. hypodermata 12 (0.13) 0 0 24 (0.75) 0 2 (0.67) 0 0 38 (0.12)
D. gallinae 1 (0.01) 0 0 0 4 (0.67) 0 0 0 5 (0.02)
Oribatida sp. 0 0 0 1 (0.03) 0 0 0 0 1 (0)
X. astia 188 (1.98) 0 17 (1.42) 0 5 (0.83) 9 (3) 0 0 219 (0.66)
X. cheopis 155 (1.63) 14 (4.67) 3 (0.25) 0 23 (3.83) 0 0 0 195 (0.59)
C. felis 0 0 0 0 0 0 165 (1.07) 31 (1.19) 196 (0.59)
Ctenophalides sp. 0 0 0 0 0 0 0 16 (0.1) 16 (0.05)
R. sanguineus* 2 (0.02) 0 0 3 (0.09) 0 0 0 0 5 (0.02)
R. haemaphysaloides** 0 0 0 5 (0.16) 0 0 0 0 5 (0.02)
Total 1287 (13.55) 38 (12.67) 20 (1.67) 988 (30.88) 110 (18.33) 86 (28.67) 165 (1.07) 47 (1.61) 2741 (8.31)

*Larva; **Nymph. L. deliense, Leptotrombidium deliense; L. keukenschrijveri, Leptotrombidium keukenschrijveri; L. indicum, Leptotrombidium indicum; L. rajesthanensis, Leptotrombidium rajesthanensis; N. microti, Neotrombicula microti; T. hypodermata, Trombicula hypodermata; D. gallinae, Dermanyssus gallinae; X. astia, Xenopsylla astia; C. felis, Ctenocephalides felis; R. sanguineus, Rhipicephalus sanguineus; R. haemaphysaloides, Rhipicephalus haemaphysaloides; S. ligula, Schoengastiella ligula

There was no month-wise significant difference among the different habitats studied for the CI (F-0.1431, df-35, P>0.05) and CIR (F-0.0561, df-35, P >0.05) (Table IV). Chigger density was influenced by the climate in each month; according to temperature, rainfall and relative humidity, the months were grouped into four seasons, i.e. southwest monsoon (June-September), northeast monsoon (October-November), winter (December-February) and summer (March-May). The winter season was dominated in all three habitats with high CI and CIR. The overall chigger collection from all the habitats was higher during cooler months, including winter and northeast monsoon, was 2377 (74%) in comparison to other months, which was about 835 (26%), showing a significant difference between cooler months and other months in the chigger collection (t-3.660, df-10, P <0.05) (Table IV).

Table IV Month-wise status of chigger infestation and indices from July 2017 to June 2018
Months Climatic status/seasons CI CIR
Urban Sub-urban Rural Result Urban Sub-urban Rural Result
July Wet and hot/south west monsoon 0 3.5 1 F=0.1431, df=35, P>0.05 0 0 3 F=0.0561, df=35, P>0.05
August 3.33 5.5 4.67 10 5.5 14
September 0 5.33 0 0 0 0
October Wet and cool/north east monsoon 6.5 7.67 10.33 13 23 15.5
November 10.75 20.83 44.43 43 41.67 77.75
December Dry and cool/winter 81 57.43 69 162 201 207
January 41.67 35.67 22.09 125 107 60.75
February 28.33 7.83 9.33 42.5 23.5 16.8
March Dry and hot/summer 33 2 4.2 33 6 21
April 0 4 2.25 0 0 9
May 9 8.8 11.5 13.5 22 23
June Wet and hot/south west monsoon 0 0 2.33 0 0 7
Mean 17.8 13.21 15.09 36.83 35.81 37.9

CI, chigger index; CIR, chigger infestation rate

Orientia tsutsugamushi prevalence in small mammals and ectoparasites: The prevalence of O. tsutsugamushi was identified by amplification of the groEL gene. Due to logistical difficulties in examining O. tsutsugamushi in all chigger mites and other ectoparasites, a representative sample of 10-50 per cent was used, i.e. urban [416 (19.7%)], sub-urban [648 (30.92%)] and rural [1035 (49.38%)] habitat. Of 2099 chiggers from all three habitats, 2081 (99.14%) chiggers were collected outdoors, which shows its abundance in outdoors alone (Table II). None of the chigger mites were positive for O. tsutsugamushi (Table V). Among the three habitats, there was no significant difference in O. tsutsugamushi positivity observed among the ectoparasites collected from indoors (χ2=0.9472, df -2, P >0.05) and outdoors (χ2=3.9679, df-2, P >0.05) host. There was also no significant difference (χ2=2.777, df-2, P >0.05) observed in O. tsutsugamushi-positive ectoparasite among three different habitats. Among the adult mites, the presence of O. tsutsugamushi was observed in Oribatida (1/1-100%) and in D. gallinae (1/2-50%). Among 5 larval ticks, 35 fleas and sera of 6 species of rodents/shrew tested; 3 ticks, 4 fleas and sera of 3 rodents/shrew were positive for O. tsutsugamushi (Table V). Among the 47 fleas collected from F. catus, two are positive for O. tsutsugamushi (Tables V and VI). There was no correlation between chiggers (pooled) and O. tsutsugamushi, but there was a correlation between ectoparasites and positive host sera samples (Tables V and VI). None of the samples were positive for spotted fever and typhus group.

Table V Positive rate of O. tsutsugamushi in ectoparasites and small mammals in Tamil Nadu, India
Ectoparasites Blood from host mammals Total number of samples Number of pools tested The number of individuals tested O. tsutsugamushi positive
Chigger* - 2099 198/198 - 0
Oribatida sp.**,b - 1 - 1 1
D. gallinae**,c - 4 - 2 1
X. astia@,c - 219 - 10 1
X. cheopis@,c - 195 - 10 1
C. felis@,d,e - 196 - 10 1d
Ctenophalides sp.@,d - 16 - 5 1d
R. sanguineusa,b - 5 - 3 2
R. haemaphysaloidesa,c - 5 - 2 1
- R. rattus# 95 - 10 1
- R. norvegicus# 3 - 2 0
- M. musculus# 12 - 2 0
- S. murinus$ 32 - 3 1
- B. bengalensis# 6 - 3 1
- T. indica# 3 - 3 0
Total 2741 198 66 12

*Larval mites; **Adult mites; @Fleas; aTicks; #Rodent; $Shrew; bShrew mites; cRodent flea; dCat flea; eDog flea; #Cat flea. X. cheopis, Xenopsylla cheopis

Table VI Identification of O. tsutsugamushi determined in this study from the blood and ectoparasites of the host
Host Blood Ectoparasites
Ticks Mites Fleas
R. rattus HG995440 HG995443 (R. haemaphysaloides*) HG995433 (X. astia*)
R. rattus - - - HG995435 (X. cheopis*)
S. murinus HG995439 HG995442 (R. sanguineus*) HG995432 (Oribatida*) -
S. murinus - HG995441 (R. sanguineus*) - -
B. bengalensis** HG995438 HG995434 (D. gallinae*) -
F. catus (cat) - - HG995436 (C. felis*)
F. catus (cat) - - HG995437 (Ctenophalides sp.*)

*First report from world; **First report in India. The ‘-‘sign indicates the absence of O. tsutsugamushi

The nucleotide sequences obtained in this study were deposited in NCBI and assigned with the accession number HG995432 to HG995443. A total of 12 nucleotide sequences were submitted (Table VI). The sequences were confirmed to be from O. tsutsugamushi by BLAST with the groEL of the known reference sequence (NC_010793). The coding sequences of the obtained sequence were compared with groEL protein reference sequence WP_012460965 and found to be closely related to the conserved region (Fig. 1). Interestingly, the sequence of O. tsutsugamushi from R. rattus blood (HG995440) and its ectoparasite R. haemaphysaloides (HG995443) was similar (

Supplementary Fig. 1A
); likewise in S. murinus blood (HG995439) and its ectoparasites (R. sanguineus -HG995442 and Oribatida sp. -HG995432) the sequence was similar (
Supplementary Fig. 1B
).

The figure shows the groEL sequence similarity between our strains to the reference sequence. (A) The nucleotide sequences (HG995432-HG995443) showing 95-100 per cent similarity with 32-79 per cent coverage with the Ikeda sequence (NC_010793/AP008981). The red vertical lines indicate the difference in sequence within the grey horizontal lines. The green and red horizontal line indicates the gene and corresponding protein, respectively. (B) The protein sequence of our strains shows high similarity (71-100%) with reference sequence WP_012460965. The amino acids are given within the grey lines. The conserved regions are shown in red. The black horizontal lines show functional gene and protein. The figure is generated using the Multiple Sequence Alignment Viewer.
Fig. 1
The figure shows the groEL sequence similarity between our strains to the reference sequence. (A) The nucleotide sequences (HG995432-HG995443) showing 95-100 per cent similarity with 32-79 per cent coverage with the Ikeda sequence (NC_010793/AP008981). The red vertical lines indicate the difference in sequence within the grey horizontal lines. The green and red horizontal line indicates the gene and corresponding protein, respectively. (B) The protein sequence of our strains shows high similarity (71-100%) with reference sequence WP_012460965. The amino acids are given within the grey lines. The conserved regions are shown in red. The black horizontal lines show functional gene and protein. The figure is generated using the Multiple Sequence Alignment Viewer.

Phylogenetic analysis: There were 174 groEL nucleotide sequences available in the NCBI database; shotgun and repeated sequences were omitted for phylogenetic analysis. Thus, the phylogenetic analysis was performed with the groEL gene from 166 sequences of O. tsutsugamushi and, Rickettsia japonica was used as an outgroup (Supplementary Table II). Based on the phylogenetic analysis, the groEL sequence clustered into four distinct clades supported by 100 per cent bootstrap. All O. tsutsugamushi identified in the study are grouped within clade IV (

Supplementary Fig. 2
). Surprisingly, the clade IV isolates are closely related to each other, indicating less genetic diversity among them, i.e. 0.042±0.009 (Table VII). The genetic divergence between clade IV and other clades ranges from 1.966±1.24 to 0.366±0.09 (Table VIII), showing clade IV has vastly diverged from other clades.

Supplementary Table II Nucleotide sequences used for phylogenetic analysis
GenBank accession number Isolate/strain name Host Source Country Year
AY059015 Boryong Human Blood South Korea 2001
AY191585 Gilliam Human Blood Burma 2002
AY191586 Kato Human Blood Japan 2002
AY191587 Kawasaki Human Blood Japan 2002
AY191588 Youngworl Human Blood South Korea 2002
AY191589 Hwasung Human Blood South Korea 2002
EF551288 FPW1038 Human Blood Thailand 2004
EF551289 FPW2016 Human Blood Thailand 2004
EF551290 FPW2031 Human Blood Thailand 2004
EF551291 FPW2049 Human Blood Thailand 2004
EF551292 UT76 Human Blood Thailand 2004
EF551293 UT125 Human Blood Thailand 2004
EF551294 UT144 Human Blood Thailand 2004
EF551295 UT150 Human Blood Thailand 2004
EF551296 UT167 Human Blood Thailand 2004
EF551297 UT169 Human Blood Thailand 2004
EF551298 UT176 Human Blood Thailand 2004
EF551299 UT177 Human Blood Thailand 2004
EF551300 UT196 Human Blood Thailand 2004
EF551301 UT213 Human Blood Thailand 2004
EF551302 UT219 Human Blood Thailand 2004
EF551303 UT221 Human Blood Thailand 2004
EF551304 UT302 Human Blood Thailand 2004
EF551305 UT329 Human Blood Thailand 2004
EF551306 UT332 Human Blood Thailand 2004
EF551307 UT336 Human Blood Thailand 2004
EF551308 UT340 Human Blood Thailand 2004
EF551309 UT395 Human Blood Thailand 2004
EF551310 UT418 Human Blood Thailand 2004
GQ499933 AH-GD-OT-S6 Human Blood China 2009
GQ499934 A-HG-DO-T-S23 Human Blood China 2009
GQ499935 AH-GD-OT-S22 Human Blood China 2009
GQ499948 BJ-MY-OT-S49 Human Blood China 2009
GQ499949 BJ-YQ-OT-S39 Human Blood China 2009
GQ499950 BJ-TZ-OT-D57 Human Blood China 2009
GQ499951 BJ-TZ-OT-O30 Human Blood China 2009
GQ499952 BJ-TZ-OT-O39 Human Blood China 2009
GQ499953 ZJ-TT-OT-O21 Human Blood China 2009
GU128878 Linh.DT No28 Human Blood Vietnam 2010
GU128879 Linh.DT No34 Human Blood Vietnam 2010
GU128880 Linh.DT No49 Human Blood Vietnam 2010
GU903938 Linh.DT No7 Human Blood Vietnam 2010
GU903942 Linh.DT No6 Human Blood Vietnam 2010
HG995432 MDUM21 Oribatida sp. S. murinus Madurai, India 2018
HG995433 TNF14 X. astia R. rattus Madurai, India 2018
HG995434 MDUM48 D. gallinae B. bengalensis Madurai, India 2018
HG995435 TNF26 X. cheopis R. rattus Madurai, India 2018
HG995436 MDUF61 Ctenocephalides sp. F. catus Madurai, India 2018
HG995437 MDUF Ctenocephalides sp. F. catus Madurai, India 2018
HG995438 MDUMA2 B. bengalensis Blood Madurai, India 2017
HG995439 MDUMA4 S. murinus Blood Madurai, India 2017
HG995440 MDUMA5 R. rattus Blood Madurai, India 2017
HG995441 MDUM26 Ixodidae tick S. murinus Madurai, India 2017
HG995442 MDUM27 Ixodidae tick S. murinus Madurai, India 2017
HG995443 MDUM3 Ixodidae tick R. rattus Madurai, India 2017
JQ894502 BJ-PG-2008 Human Blood China 2008
JX188387 TD-17 Human Blood Japan 2012
JX188388 TD-7 Human Blood Japan 2012
JX188389 SH216 Human Blood Japan 2012
JX188390 Isolate 5-05 Human Blood Japan 2012
JX188391 Kaisei Rodent - Japan 1993
JX188392 Sato Human Blood Japan 1990
JX188393 Kato Human Blood Japan 2012
JX188394 Kuroki Human Blood Japan 2012
JX188395 Shimokoshi Human Blood Japan 1980
JX188396 UAP1 Rodent Liver spleen Japan 1996
JX188397 UAP4 Rodent Liver spleen Japan 1996
JX188398 UAP7 Rodent Liver spleen Japan 1997
JX188399 FAR1 Rodent Liver spleen Japan 1997
JX188400 HSB1 Rodent Liver spleen Japan 1996
JX188401 HSB2 Rodent Liver spleen Japan 1996
JX188402 SH216 Rodent Blood Japan 2012
JX235718 Sato Human Blood Japan 1990
JX235719 Kaisei Rodent - Japan 1993
JX235720 TD-17 Human Blood Japan 2012
JX235721 Isolate 5–05 Human Blood Japan 2012
JX235722 TD-7 Human Blood Japan 2012
KC485338 Jin/2012 Human Blood Japan 2012
KC485339 Liu/2011 Human Blood Japan 2011
KC485340 Zhou/2012 Human Blood Japan 2012
KC688320 KNP1 Rodent/A. speciosus - Japan 1996
KC688321 KNP2 Rodent/A. speciosus - Japan 1997
KC688322 Isolate O2 Rodent/A. speciosus Japan 1984
KC688323 Isolate O3 Rodent/A. speciosus - Japan 1984
KC688324 Matsuzawa Human Blood Japan 1984
KC688325 UAP6 Rodent/A. speciosus - Japan 1997
KC688326 FAR2 Rodent/A. speciosus - Japan 1997
KC688327 HSB3 Rodent/A. speciosus - Japan 1996
KC688328 CMM1 Rodent/A. speciosus - Japan 1997
KC688329 UAP2 Rodent/A. speciosus - Japan 1996
KC688330 Isolate O2 Rodent/A. speciosus - Japan 1984
KC688331 Isolate O3 Rodent/A. speciosus - Japan 1984
KC688332 SH205 Rodent/A. speciosus - Japan 2008
KC688333 SH234 Rodent/A. speciosus - Japan 2004
KC688334 SH245 Rodent/A. speciosus - Japan 2007
KC693730 SH205 Rodent/A. speciosus - Japan 2008
KC693731 SH234 Rodent/A. speciosus - Japan 2004
KC693732 SH245 Rodent/A. speciosus - Japan 2007
KJ001160 Mu/2013 Human Blood China 2013
KT970942 SS281 Human Blood Puducherry, India 2013
KT970943 ISE560 Human Blood Puducherry, India 2013
KX432184 GKP-R148 Human Blood Uttar Pradesh, India 2015
KX432185 GKPR115 Human Blood Uttar Pradesh, India 2015
KY120975 Rodent Rodent/T. triton Spleen China 2013
KY701320 Wuj/2014 Human Blood China 2014
MG601918 N8515 Human Blood Puducherry, India 2016
MG601919 KOT0115 Human Blood Puducherry, India 2016
MG601920 N8815 Human Blood Puducherry, India 2015
MG601921 JA5516 Human Blood Puducherry, India 2016
MG601922 S4013 Human Blood Puducherry, India 2013
MG601923 JA2616 Human Blood Puducherry, India 2016
MG601924 JA7615 Human Blood Puducherry, India 2015
MG601925 JA7815 Human Blood Puducherry, India 2015
MG601926 D12915 Human Blood Puducherry, India 2015
MG601927 JA9914 Human Blood Puducherry, India 2014
MG601928 JA0916 Human Blood Puducherry, India 2016
MG601929 JA2416 Human Blood Puducherry, India 2016
MG601930 FB3415 Human Blood Puducherry, India 2015
MG601931 D2615 Human Blood Puducherry, India 2015
MG601932 ST3015 Human Blood Puducherry, India 2015
MG601933 ST4915 Human Blood Puducherry, India 2015
MG601934 ST8915 Human Blood Puducherry, India 2015
MG601935 FB4116 Human Blood Puducherry, India 2016
MG601936 D12315 Human Blood Puducherry, India 2015
MG601937 D6915 Human Blood Puducherry, India 2015
MG601938 D7215 Human Blood Puducherry, India 2015
MG601939 D8315 Human Blood Puducherry, India 2015
MG601940 JA33/16 Human Blood Puducherry, India 2016
MG601941 JA1616 Human Blood Puducherry, India 2016
MG601942 JA3816 Human Blood Puducherry, India 2016
MG601943 JA4716 Human Blood Puducherry, India 2016
MG601944 JA5716 Human Blood Puducherry, India 2016
MG601945 JA6416 Human Blood Puducherry, India 2016
MG601946 JA5916 Human Blood Puducherry, India 2016
MG601947 JA7616 Human Blood Puducherry, India 2016
MG601948 JA8816 Human Blood Puducherry, India 2016
MG601949 JA15316 Human Blood Puducherry, India 2013
MG601950 JA12316 Human Blood Puducherry, India 2016
MG601951 JA12416 Human Blood Puducherry, India 2016
MG601952 JA12716 Human Blood Puducherry, India 2016
MG601953 JA12916 Human Blood Puducherry, India 2016
MG601954 S2813 Human Blood Puducherry, India 2013
MG601955 OT47/13 Human Blood Puducherry, India 2013
MG601956 FB3616 Human Blood Puducherry, India 2016
MG601957 JA15416 Human Blood Puducherry, India 2016
MG601958 N0915 Human Blood Puducherry, India 2015
MG601959 D9415 Human Blood Puducherry, India 2015
MG958654 R161 Rodent - Uttar Pradesh, India 2015
MG958655 R167 Rodent Uttar Pradesh, India 2016
MG958656 R200 Rodent - Uttar Pradesh, India 2016
MG958657 R212 Rodent - Uttar Pradesh, India 2016
MG958658 R220 Rodent - Uttar Pradesh India 2016
MG958659 R238 Rodent - Uttar Pradesh, India 2016
MH595491 FSS680 Human Blood Australia 2013
MH595492 FSS445 Human Blood Australia 2014
MH758790 N57_15 Human Blood Puducherry, India 2015
AM494475 Boryong Human Blood South Korea 1995
AP008981 Ikeda Human Blood Japan 1979
LS398547 UT176 Human Blood Thailand 2004
CP044031 Wuj/2014 Human Blood China 2014
LS398548 Karp Human Blood New Guinea 1943
LS398549 TA686 Rodent/T. glis - Thailand 1963
LS398550 Kato Human Blood Japan 1955
LS398551 Gilliam Human Blood India Burma Border 1943
LS398552 UT76 Human Blood Thailand 2003
OUNA01000005 TA763 Rodent/R. rajah - Thailand 1963

X. astia, Xenopsylla astia; D. gallinae, Dermanyssus gallinae; X. cheopis, Xenopsylla cheopis; B. bengalensis, Bandicota bengalensis; S. murinus, Suncus murinus; R. rattus, Rattus rattus; A. speciosus, Apodemus speciosus; T. glis, Tupaia glis; T. triton, Tscherskia triton, R. rajah, Rattus rajah

Table VII Estimates of average evolutionary divergence over sequence pairs within groups
Clade Average evolutionary divergence
Clade I 0
Clade II 1.405±1.073
Clade III 0.220±0.088
Clade IV 0.042±0.009#
Outgroup 0.007±0.007

#Clades representing our sequences. The numbers of base substitutions per site from averaging over all sequence pairs within each clade are shown. The values given are as distance and standard error estimate(s). Analyses were conducted using the MCL model using MEGA7. The analysis involved 167 nucleotide sequences. There were a total of 142 positions in the final dataset. MCL, maximum composite likelihood

Table VIII Estimates of net evolutionary divergence between groups of sequences
Clade Clade I Clade II Clade III Clade IV Out group
Clade I 0.726* 0.855* 1.24#* 1.608*
Clade II 0.952 0.794* 1.24#* 1.226*
Clade III 1.449 1.372 0.939#* 0.906*
Clade IV 1.966# 1.643# 1.54# 0.09#*
Out group 1.939 1.585 1.346 0.366#

#Clades representing our sequences. The numbers of base substitutions per site from estimation of net average between clades are shown. *Standard error estimate(s) are shown above the diagonal. Analyses were conducted using the MCL model using MEGA7. The analysis involved 167 nucleotide sequences. There were a total of 142 positions in the final dataset

Discussion

Rickettsial diseases, especially scrub typhus, is an emerging infectious disease and reported in several parts of India15. Rodents and shrews make an active role in the infestation of chiggers, flea and ticks to transmit rickettsial diseases203738. Scrub typhus cases were reported in the human population around Madurai21. In our study, we have observed O. tsutsugamushi in ticks (R. haemaphysaloides, R. sanguineus), fleas (X. astia, X. cheopis) and in non-trombiculid mites (D. gallinae and Oribatida sp.) from rodents and C. felis from F. cattus. As per our knowledge, this is the first-ever report of its kind in these species.

Ticks and fleas: Ticks are reported as carriers of O. tsutsugamushi1737383940. Ticks, especially Haemaphysalis hystricis, H. flava41 Ixodes spp.17 and Ixodes granulatus4243 are said to be vectors for O. tsutsugamushi. In our study, we have found O. tsutsugamushi in two tick species, R. sanguineus and R. haemaphysaloides. Fleas are ineffective as vectors of O. tsutsugamushi; however, it can maintain live pathogens for 11 days and transmit by biting44. However till date, there are no reports on fleas as a vector for the transmission of scrub typhus in humans. Chareonviriyaphap et al16 tested nearly 504 specimens of fleas (X. cheopis) for O. tsutsugamushi and none were positive. Similarly, O. tsutsugamushi was reported to be absent in C. orientis, C. f. felis and C. canis45. Howerver, in this study, O. tsutsugamushi was observed in X. cheopis, X. astia, Ctenophalides sp. and C. felis. However, it is not evident from this study whether these species will act as vectors for scrub typhus, the future study will be carried out in this regard.

Trombiculid ectoparasites: Trombiculid ectoparasites are the major vectors in transmitting O. tsutsugamushi. Majority of the reports show that O. tsutsugamushi was tested positive in trombiculid mites, particularly in the genus Leptotrombidium followed by Eutrombicula wichmanni, Odontacarus sp., M. chamlongi, Neotrombicula japonica and Helenicula miyagawai46. Leptotrombidium deliense was the most abundant species of trombiculid mite and it was reported as the predominant vector for scrub typhus infection in India and other countries646. Two hundred and four species of trombiculid mites were reported from India and four chigger mites, namely S. ligula, L. deliense, L. subintermedium and L. dihumerale were considered as the vectors for scrub typhus transmission26. In our study, we could collect only trombiculid mites L. deliense and S. ligula from the sites and unfortunately, they were negative for scrub typhus pathogens.

Non-trombiculid ectoparasites: Recently, non-trombiculid ectoparasites have been reported as vectors for O. tsutsugamushi46. Non-trombiculid ectoparasites such as Echinolaelaps echidninus43 Laelaps turkestanicus43 and Ornithonyssus bacoti141517 are said to host O. tsutsugamushi. Interestingly in this study, O. tsutsugamushi was found for the first time in non-trombiculid ectoparasites Oribatida sp., and D. gallinae.

Rodents/shrew: Several reports are available for O. tsutsugamushi infection in small mammals1647484950. R. rattus1516474849 S. murinus15 R. norvegicus1650 B. indica164849 R. bukit, R. argentiventer, R. berdmorei, R. losea, R. koratensis, B. savilei, R. exulans48 and Tupaia glis4748. In most cases, the prevalence rates were very low, i.e. ≤1 per cent15164950 with the exception where of Coleman et al48 and Frances et al47 reported 1-25 per cent prevalence rate. In this study, we detected O. tsutsugamushi in the blood of R. rattus (1/95-1.05%), S. murinus (1/32-3.13%) and B. bengalensis (1/6-16.7%). Interestingly, O. tsutsugamushi from R. rattus (

Supplementary Fig. 1A
), S. murinus (
Supplementary Fig. 1B
) and B. bengalensis (
Supplementary Fig. 1C
) and it is ectoparasites are closely related to each other, which indicates the possible transmission of O. tsutsugamushi from ectoparasite to host and vice versa. The transmission between host and ectoparasites will be studied in the future.

Phylogenetics of Orientia tsutsugamushi: GroEL gene has been used to distinguish scrub typhus from other rickettsial diseases13. Till date, O. tsutsugamushi genotypes have been reported from Japan (Kato, Hirano, Kuroki, Shimokoshi, Ikeda, Yamamoto, Kawasaki, Saitama), Thailand (TA678, TA763, TA716, TH1817), New Guinea (Karp, Kostival, Buie), South Korea (Boryong, Yonchon), Assam-Burma Border (Gilliam), Russia (B15), Australia (Litchfield) and Philippines (Volner)51 and India (IHS2252). According to Enatsu et al53 there were 31 serotypes (later called genotypes) based on the presence or absence of a 56 kDa type-specific gene (also called TSA gene); however, Arai et al54 found that groEL gene has strong conservation rather than the 56 kDa gene which is also distinct from other Rickettsia species. In India, 56 kDa gene has been used to study strain prevalence rate, Karp-like2252555657 Kato-like56 strains are more prevalent and the least prevalent are Gilliam-like22525658and TA678 strains2252. New genotypes denoted as IHS has been identified in Shimla5556.

Recently, Batty et al59 have sequenced the complete genome of six O. tsutsugamushi strains, namely Karp (including UT76 and UT176), Kato, Gilliam, TA686, TA763 and TA716 (FPW1038) and compared them with existing reference strains Boryong and Ikeda. Based on the 657 core genes observation, Kato and Ikeda’s strains are more closely related to Karp strains (incl. UT76 and UT176) than TA686 and Gilliam, as reported in 56 kDa tree59. It is also noted that a particular gene or a single gene could not be used for strain identification, i.e. Karp-like and Kato-like. In this study, it was observed that groEL of Karp (LS398548) and Ikeda (NC_010793/AP008981) reference strains shared about 98.5 per cent identity, i.e. only 25 mismatch nucleotides (

Supplementary Fig. 1D
); showing their high relatedness to each other. Furthermore, also our sequences showed BLAST match of 95-100 per cent (coverage 75-79%) with NC_010793 (Fig. 1A and B). In contrast, our phylogenetic analysis showed LS398548 in clade I while AP008981 in clade IV (
Supplementary Fig. 2
), it might be due to evolutionary divergence. To assess, an evolutionary timeline was generated in BEAST using 16S rRNA and groEL genes from the available genome sequences resulting in different divergence for each gene (
Supplementary Fig. 3
), which proves that evolutionary divergence is the cause for the difference of grouping in clades. It was also noted the divergence within clade IV that included our sequences was less, i.e. 0.042±0.009 (Table VII).

Taken together, we report that our sequences belong to O. tsutsugamushi; however, at this time, we were unsure of placing it as a particular strain due to lack of complete genome sequence. Taken together, our observation pointed out only the rural outdoor collected rodents/shrews such as R. rattus, B. bengalensis and S. murinus and their ectoparasites were positive for scrub typhus pathogen, O. tsutsugamushi. We believe that this is the first report for the presence of O. tsutsugamushi in B. bengalensis as well. Contrary to the claim that among the ectoparasites, established vectors trombiculid mites were found to be negative for O. tsutsugamushi in the study areas; however, adult non-trombiculid mites such as Oribatida species, Dermanyssus gallinae, fleas (Xenopsylla astia, X. cheopis, Ctenophalides felis, Ctenophalides sp.) and ticks (Rhipicephalus sanguineus, R. haemaphysaloides) were found to be positive for O. tsutsugamushi and this is a first report globally. Although there are no reports on these ectoparasites as vectors for scrub typhus, there is a possibility that these ectoparasites may act as a vector in the transmission of scrub typhus. Further research will be carried out to assess whether these ectoparasites act as vectors in the transmission of scrub typhus.

The O. tsutsugamushi groEL gene sequence similarity was much pronounced between the host and their ectoparasites, indicating the transmission of the pathogen to the host or vice versa, which shows the transmission of scrub typhus pathogen between host and its ectoparasites in this region. Since both rodents/shrews and the ectoparasite vectors live near the human niche, there is a possibility of risk for the transmission of scrub typhus. Thus, it is suggested to undertake routine host/vector/pathogen surveillance to identify hotspots to implement appropriate preventive measures. However, it needs further validation and confirmation, followed by laboratory experiments to prove the potential transmission of the acquired infection by the newer ectoparasites. The outcome of this study gains much public health importance to design appropriate preparedness for control measures and to sensitize medical practitioners for early diagnosis and treatment to reduce mortality associated with scrub typhus.

Financial support and sponsorship

None.

Conflicts of interest

None.

Supplementary Fig. 1

Supplementary Fig. 1 The figure shows the groEL sequence similarity between the sequence obtained from blood and ectoparasite of rodents – (A) Rattus rattus, (B) Suncus murinus and (C) Bandicoot bengalensis. The ectoparasites are: ticks - Rhipicephalus haemaphysaloides (HG995443) and Rhipicephalus sanguineus (HG995441, HG995442), non-trombiculid mites – Oribatida sp., (HG995432) and Dermanyssus gallinae (HG995434) and, fleas – Xenopsylla astia (HG995433) and X. cheopis (HG995435). (D) Consensus sequence between groEL of Ikeda (NC_010793/AP008981) and Karp (LS398548) strain. The Karp strain has 98.5 per cent sequence similarity (100% coverage) with the Ikeda strain. The figure is generated using the Multiple Sequence Alignment Viewer.

Supplementary Fig. 2

Supplementary Fig. 2 The phylogenetic analysis was performed in RAxML. There are 167 groEL sequences in the phylogenetic tree including sequence from R. japonica which serve as an outgroup. There were four distinctive clades. Clade I comprise majority of strains from Vietnam. Clade II comprise strains from Australia. Clade III comprise Japanese strains including Sato and Kaisei. The rest of the nucleotide sequences cluster in Clade IV. Our isolates from this study clusters in Clade IV (Label font and branches are given in green). Other strains from India are given in given in sandal colour.

Supplementary Fig. 3

Supplementary Fig. 3 The evolutionary divergence was given in this image for the 16S rRNA (A) and groEL (B) gene obtained from the whole genome sequence of eight strains/genotypes. The tree shows divergence is different for these two genes from multiple genomes. In 16S rRNA, the divergence of Ikeda (NC_010793/AP008981 – red box) strain is closer to the Kato strain; however, in groEL, it is distant with other strains. For Karp (LS398548 – green box) strain, 16S rRNA shows closer evolution with other Karp (UT176, UT76), TA763 and Wuj/2014 strains and, in the case of groEL, it shows closer evolution with other Karp (UT76, UT176), TA686, TA763 and Wuj/2014 strains. The difference in both genes is due to different evolutionary time point. The tree is generated using Figtree (v1.4.4). The evolutionary analysis was done using BEAST (JREv2.6.6) after running model test in RAxML (gui 2.0.6). The site model, clock and priors are selected according to model test parameters and the run was performed for 10,000,000 repeats. The quality of the analysis was checked using Tracer (v.1.7.2) and where effective sample size (ESS) was above 200.

References

  1. , , , , , . Estimating the burden of scrub typhus: A systematic review. PLoS Negl Trop Dis. 2017;11:e0005838.
    [Google Scholar]
  2. , , , . A systematic review of mortality from untreated scrub typhus (Orientia tsutsugamushi) PLoS Negl Trop Dis. 2015;9:e0003971.
    [Google Scholar]
  3. , , , , , , . Orientia, Rickettsia, and Leptospira pathogens as causes of CNS infections in Laos: A prospective study. Lancet Glob Health. 2015;3:e104-12.
    [Google Scholar]
  4. , , , , , , . Neurological manifestations of scrub typhus infection: A systematic review and meta-analysis of clinical features and case fatality. PLoS Negl Trop Dis. 2022;16:e0010952.
    [Google Scholar]
  5. , . Scrub typhus –Scientific neglect, ever-widening impact. N Engl J Med. 2016;375:913-5.
    [Google Scholar]
  6. , , , , , . A review of the global epidemiology of scrub typhus. PLoS Negl Trop Dis. 2017;11:e0006062.
    [Google Scholar]
  7. , , , , , . Identification of the target cells of Orientia tsutsugamushi in human cases of scrub typhus. Mod Pathol. 2001;14:752-9.
    [Google Scholar]
  8. , , , , . Classification of Rickettsia tsutsugamushi in a new genus, Orientia gen. nov., as Orientia tsutsugamushi comb. nov. Int J Syst Bacteriol. 1995;45:589-91.
    [Google Scholar]
  9. , , , , , , . Influence of Orientia tsutsugamushi infection on the developmental biology of Leptotrombidium imphalum and Leptotrombidium chiangraiensis (Acari: Trombiculidae) J Med Entomol. 2012;49:1270-5.
    [Google Scholar]
  10. , , , , , , . Diagnosis of scrub typhus: Recent advancements and challenges. 3 Biotech. 2020;10:396.
    [Google Scholar]
  11. , , , , , , . How to determine the accuracy of an alternative diagnostic test when it is actually better than the reference tests: A re-evaluation of diagnostic tests for scrub typhus using Bayesian LCMs. PLoS One. 2015;10:e0114930.
    [Google Scholar]
  12. , , , , , , . Differentiation of Rickettsiae by groEL gene analysis. J Clin Microbiol. 2003;41:2952-60.
    [Google Scholar]
  13. , , , , , , . Rapid and simple identification of Orientia tsutsugamushi from other group Rickettsiae by duplex PCR assay using groEL gene. Microbiol Immunol. 2005;49:545-9.
    [Google Scholar]
  14. , , , , , , . Prevalence and phylogenetic analysis of Orientia tsutsugamushi in rodents and mites from central India. Vector Borne Zoonotic Dis. 2017;17:749-54.
    [Google Scholar]
  15. , , , , , , . Abundance &distribution of trombiculid mites &Orientia tsutsugamushi, the vectors &pathogen of scrub typhus in rodents &shrews collected from Puducherry &Tamil Nadu, India. Indian J Med Res. 2016;144:893-900.
    [Google Scholar]
  16. , , , , , . Dual exposure of Rickettsia typhi and Orientia tsutsugamushi in the field-collected Rattus rodents from Thailand. J Vector Ecol. 2014;39:182-9.
    [Google Scholar]
  17. , , , , , , . Molecular epidemiology of Orientia tsutsugamushi in chiggers and ticks from domestic rodents in Shandong, Northern China. Parasit Vectors. 2013;6:312.
    [Google Scholar]
  18. , , , , , , . Characterization based on the 56-Kda type-specific antigen gene of Orientia tsutsugamushi genotypes isolated from Leptotrombidium mites and the rodent host post-infection. Am J Trop Med Hyg. 2014;90:139-46.
    [Google Scholar]
  19. , , , , , . Distribution pattern of chigger mites in South Tamil Nadu, India. ENTOMON. 2021;46:247-54.
    [Google Scholar]
  20. , , , , . Ectoparasites of some wild rodents/shrews captured from scrub typhus reported areas in Tamil Nadu, India. Int J Acarol. 2021;47:218-21.
    [Google Scholar]
  21. , , , , , , . Epidemiology &risk factors of scrub typhus in South India. Indian J Med Res. 2016;144:76-81.
    [Google Scholar]
  22. , , , , , , . Occurrence of Orientia tsutsugamushi, the etiological agent of scrub typhus in animal hosts and mite vectors in areas reporting human cases of acute encephalitis syndrome in the Gorakhpur region of Uttar Pradesh, India. Vector Borne Zoonotic Dis. 2018;18:539-47.
    [Google Scholar]
  23. , , . Distribution of rodents in Indian agriculture. In: In: Technical bulletin. Vol Vol. 13. Jodhpur, India: Central Arid Zone Research Institute, Jodhpur; .
    [Google Scholar]
  24. , , , . Handbook of mammals of Kerala. India: Zoological Survey of India; .
    [Google Scholar]
  25. , , . A key to soil mites in the UK. Available from: https://www.brc.ac.uk/psl/resource/key-soil-mites-uk
    [Google Scholar]
  26. , , . Studies on the trombiculid mite fauna of India. India: Zoological Survey of India, Kolkata;2003 :212.
    [Google Scholar]
  27. , , . Haemaphysalis ticks of India. USA: Elsevier Science; .
    [Google Scholar]
  28. , , , , . A glossary of chigger terminology (Acari: Trombiculidae) J Med Entomol. 1982;19:221-38.
    [Google Scholar]
  29. , . An illustrated key to the species of the acarine genus Dermanyssus (Mesostigmata: Laelapoidea: Dermanyssidae) J Med Entomol. 1968;5:67-84.
    [Google Scholar]
  30. , , . A pictorial key to the subfamilies, genera and subgenera of Southeast Asian chiggers (Acari, Prostigmata, Trombiculidae) Bull Insti Med Res Malaysia;. 1974;16:1-67.
    [Google Scholar]
  31. , . A revision of Indian Ixodidae with special reference to the collections in the India-Records of the Indian museum. Rec Indian Mus Zool Surv India Calcutta. 1928;30:217-344.
    [Google Scholar]
  32. , . A revision of the Indian Siphonaptera Part-I family Pulicidae. Rec Indian Mus Zool Surv India Calcutta. 1930;32:29-62.
    [Google Scholar]
  33. , , , , , , . Laboratory diagnosis and genotype identification of scrub typhus from Pinggu district, Beijing, 2008 and 2010. Am J Trop Med Hyg. 2013;89:123-9.
    [Google Scholar]
  34. , , , , , . raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol Evol. 2021;12:373-7.
    [Google Scholar]
  35. , . Maximum likelihood estimation of phylogenetic trees is consistent when substitution rates vary according to the invariable sites plus gamma distribution. Syst Biol. 2001;50:713-22.
    [Google Scholar]
  36. , , , . MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870-4.
    [Google Scholar]
  37. , , . Rickettsioses in children –A review. Indian J Pediatr. 2020;87:930-6.
    [Google Scholar]
  38. , , , , , . Rickettsioses in Europe. Microbes Infect. 2015;17:834-8.
    [Google Scholar]
  39. , , , , , , . Spatial distribution of Haemaphysalis species ticks and human Kyasanur forest disease cases along the Western Ghats of India, 2017-2018. Exp Appl Acarol. 2019;77:435-47.
    [Google Scholar]
  40. , , , . Molecular detection and genetic identification of rickettsia infection in Ixodes granulatus Ticks, an incriminated vector for geographical transmission in Taiwan. Microorganisms. 2021;9:1309.
    [Google Scholar]
  41. , , , , , , . Canine Orientia tsutsugamushi infection: Report of a case and its epidemicity. Southeast Asian J Trop Med Public Health. 2014;45:395-401.
    [Google Scholar]
  42. , , , , . Studies on scrub typhus in China. Hongkong: Asia Medicine Press; .
    [Google Scholar]
  43. , , , , . Epidemiology and ecology of rickettsial diseases in the people's republic of China. Rev Infect Dis. 1987;9:823-40.
    [Google Scholar]
  44. , , . The ecology of chigger-borne rickettsiosis (scrub typhus) J Med Entomol. 1974;11:237-303.
    [Google Scholar]
  45. , , , . Survey of Rickettsia spp. and Orientia tsutsugamushi pathogens found in animal vectors (ticks, fleas, chiggers) in Bangkaew district, Phatthalung province, Thailand. Korean J Parasitol. 2019;57:167-73.
    [Google Scholar]
  46. , , , , , , . Scrub typhus ecology: A systematic review of Orientia in vectors and hosts. Parasit Vectors. 2019;12:513.
    [Google Scholar]
  47. , , , , . Occurrence of Orientia tsutsugamushi in chiggers (Acari: Trombiculidae) and small animals in an orchard near Bangkok, Thailand. J Med Entomol. 1999;36:449-53.
    [Google Scholar]
  48. , , , , , , . Occurrence of Orientia tsutsugamushi in small mammals from Thailand. Am J Trop Med Hyg. 2003;69:519-24.
    [Google Scholar]
  49. , , , , , , . Heterogeneity of Orientia tsutsugamushi genotypes in field-collected trombiculid mites from wild-caught small mammals in Thailand. PLoS Negl Trop Dis. 2018;12:e0006632.
    [Google Scholar]
  50. , , , , , , . Prevalence and phylogenetic analysis of Orientia tsutsugamushi in small mammals in Hanoi, Vietnam. Vector Borne Zoonotic Dis. 2016;16:96-102.
    [Google Scholar]
  51. , , , , . Scrub typhus: The geographic distribution of phenotypic and genotypic variants of Orientia tsutsugamushi. Clin Infect Dis. 2009;48:S203-30.
    [Google Scholar]
  52. , , , , , , . Seasonal abundance of Leptotrombidium deliense, the vector of scrub typhus, in areas reporting acute encephalitis syndrome in Gorakhpur district, Uttar Pradesh, India. Exp Appl Acarol. 2021;84:795-808.
    [Google Scholar]
  53. , , , . Phylogenetic analysis of Orientia tsutsugamushi strains based on the sequence homologies of 56-kDa type-specific antigen genes. FEMS Microbiol Lett. 1999;180:163-9.
    [Google Scholar]
  54. , , , , , , . Molecular phylogenetic analysis of Orientia tsutsugamushi based on the groES and groEL genes. Vector Borne Zoonotic Dis. 2013;13:825-9.
    [Google Scholar]
  55. , , , , , , . Scrub typhus in Himalayas. Emerg Infect Dis. 2006;12:1590-2.
    [Google Scholar]
  56. , , , , , , . Molecular epidemiology and genetic diversity of Orientia tsutsugamushi from patients with scrub typhus in 3 regions of India. Emerg Infect Dis. 2015;21:64-9.
    [Google Scholar]
  57. , , , , , , . Use of eschar for the molecular diagnosis and genotypic characterisation of Orientia tsutsugamushi causing scrub typhus. Indian J Med Microbiol. 2018;36:422-5.
    [Google Scholar]
  58. , , , , , , . Development of a real-time PCR assay for the diagnosis of scrub typhus cases in India and evidence of the prevalence of new genotype of O. tsutsugamushi. Acta Trop. 2007;104:63-71.
    [Google Scholar]
  59. , , , , , , . Long-read whole genome sequencing and comparative analysis of six strains of the human pathogen Orientia tsutsugamushi. PLoS Negl Trop Dis. 2018;12:e0006566.
    [Google Scholar]
Show Sections
Scroll to Top