Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
View/Download PDF

Translate this page into:

Practice: Original Article
158 (
1
); 55-65
doi:
10.4103/ijmr.IJMR_2976_20

Molecular detection of drug-resistant Plasmodium falciparum mutants in Assam

Department of Microbiology, Apollo Excelcare Hospital, Guwahati, India
Department of Microbiology, Gauhati Medical College, Guwahati, India
Department of Medicine, Assam Medical College, Dibrugarh, Assam, India
Department of Statistics, Assam Medical College, Dibrugarh, Assam, India
Department of Regional Medical Research Centre, Dibrugarh, Assam, India

For correspondence: Dr Ajanta Sharma, Department of Microbiology, Gauhati Medical College, Guwahati 781 032, Assam, India e-mail: ajantasharma2002@yahoo.com

Licence
This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.
Disclaimer:
This article was originally published by Wolters Kluwer - Medknow and was migrated to Scientific Scholar after the change of Publisher.

Abstract

Background & objectives:

The spread of drug-resistant Plasmodium falciparum (Pf) poses a serious threat to the control and elimination of malaria. The objective of this study was to detect the molecular biomarkers of antimalarial drug resistance in Pf in patients visiting a tertiary care hospital in Assam.

Methods:

Malaria was first detected in fever cases using microscopy and a rapid diagnostic test (RDT), and then confirmed using PCR. Pf chloroquine resistance transporter (Pfcrt), Pf multidrug resistance-1 (Pfmdr-1), and single-nucleotide polymorphisms linked to delayed parasite clearance after treatment with artemisinin MAL 10-688956 and MAL 13-1718319 and Kelch-13 propeller (PfK-13) genes were evaluated by PCR-restriction fragment length polymorphism (RFLP).

Results:

Sixty nine cases of malaria were found among 300 cases of fever. Of these, 54 were positive for Pf, 47 of which were confirmed by PCR. Pfcrt-K76T mutation was seen in 96.6 per cent and Pfmdr1-N86Y mutation in 84.2 per cent of cases. Mutation was not detected in MAL10 and MAL13 genes. Sequence analysis of Kelch-13 gene showed the presence of a novel mutation at amino acid position 675. Statistically, no significant association was found between the molecular biomarkers and demographic profile, clinical presentation and outcome of the cases.

Interpretation & conclusions:

Molecular surveillance is essential to assess the therapeutic efficacy of the drugs against circulating Pf isolates in Assam which are found to be highly resistant to CQ. The role of the new mutation found in the Kelch-13 gene in the development of artemisinin resistance in Assam needs to be thoroughly monitored in future research.

Keywords

Artemisinin
Assam
chloroquine
drug resistance
mutants
Plasmodium falciparum

Malaria is a significant public health problems in India. Most of the tropics endure it as an endemic disease. It imposes great socioeconomic burden on humanity1,2. A protozoan species of the genus Plasmodium causes the vector-borne disease malaria, which is transmitted to humans by female anopheles mosquitoes.

Presently, chemotherapy is the sole effective measure for malaria since there is no protective vaccination against it3. Plasmodium falciparum (Pf) has become resistant to most of the currently used drugs4. Over the last two decades, resistance to all kinds of antimalarial drugs has emerged with the exception of artemisinin derivatives. The problem of antimalarial resistance is more pronounced with Pf5,6.

Due to increasing failure of antimalarial drugs, it has become essential to study the molecular mechanisms involved in underlying resistance and to identify the molecular biomarkers so that appropriate measures can be taken in time to reduce the mortality and complications arising due to Pf malaria7. Molecular methods such as PCR can be used to detect the molecular biomarkers that confer resistance to antimalarial drugs.

Chloroquine resistance (CQR) has been linked to two genes in Pf: the multidrug-resistant gene pfmdr1 and the CQR transporter gene pfcrt. The pfmdr1-N86Y mutation can enhance the effect of the main resistance gene pfcrt-K76T mutation8-10. The in vitro responses to CQ, mefloquine, lumefantrine, quinine, monodesethylamodiaquine, and DHA11 have likewise been linked to these two mutations. Genetic cross-studies revealed the candidate gene for CQR as pfcrt, which is found on chromosome 78. The K76T mutation in pfcrt may alter CQ flux or impair drug binding to hematin by affecting the pH 12 of the digesting vacuole11. The World Health Organization has recommended artemisinin based combination therapy (ACTs) as the first line treatment against uncomplicated Pf infection as these are well tolerated, highly efficacious, and safe12. However, as ACTs have been used more frequently, their therapeutic impact has gradually diminished. In 2008, in western Cambodia, the emergence of Pf resistance to artemisinin and its variants was first noted13. In 2014, Ariey et al14 identified K13-propeller as a molecular marker for artemisinin resistance. One characteristic feature to identify these ACT-resistant strains is a delay in the parasite clearance post-treatment. A genomic region linked to such a delay in parasite clearance after ACT was identified in 2012 for artemisinin and its derivatives15 following which four single nucleotide polymorphisms (SNPs) on chromosomes 10, 13, and 14, linked to the delayed clearance phenotype were discovered16. Of these, MAL10-688956 (A) and MAL13-1718319 (T) were proposed to be suitable molecular markers for the resistance trait.

It is thought that Assam, a state in north-eastern (NE) India that serves as a corridor to south-east Asia, plays a crucial role in the spread of drug resistant Pf malaria to south Asia and India17. To date, only a few studies have evaluated the role of mutations in pfmdr1 and pfcrt genes in the emergence of Pf CQR. Although research from other Indian regions have noted a poor association between these gene mutations and CQR, no thorough study has yet been conducted on this. Additionally, effective antimalarial drug treatment and, malaria control, as well as elimination are all threatened by the emergence of antimalarial drug resistance. All endemic countries use ACTs as the first line of treatment for uncomplicated falciparum malaria; nevertheless, partial artemisinin resistance has developed in many areas, including southeast Asia.

Therefore, this study was undertaken to detect the molecular biomarkers pfmdr1 and pfcrt genes and their mutations in samples from falciparum malaria patients visiting Assam Medical College, Dibrugarh, Assam, including four districts (Tinsukia, Sivasagar, Dibrugarh and Dhemaji) which were not included in the earlier studies carried out in Assam and a neighbouring State Arunachal Pradesh18,19. The study also aimed to analyze the SNPs at the loci MAL10-688956 and MAL13-1718319; and Kelch-13 propeller gene for artemesinin resistance in patients suffering from falciparum malaria in this region. Given that there is an urgent need to know if K13-propeller mutations linked to delayed parasitic clearance are currently in circulation considering the vital role that artemisinin-based combinations play in the control and elimination of malaria. The findings of this study may support further molecular monitoring of drug-resistant Pf in Assam and will aid in the development and revision of antimalarial recommendations.

Material & Methods

Individuals of all age group and both sex admitted to the department of Medicine, Assam Medical College and Hospital, Dibrugarh, with clinically suspected malaria were examined and investigated after taking a written informed consent from the patients or their attendants between June 2015 to May 2016. The surveillance was carried out in the outpatient department and wards in collaboration with department of Medicine in the same hospital. Approval was obtained from the Institutional Ethics Committee before initiation of the study.

Inclusion criteria: Regardless of age or gender, all confirmed cases of Pf malaria, with or without complications were included in this study. According to the WHO criteria for complications in individuals with cerebral malaria, severe anaemia, renal failure, acute respiratory distress syndrome, hypoglycemia, hypotension, convulsions, disseminated intravascular coagulation, acidosis, macroscopic haemoglobinuria, and jaundice were included.

Exclusion criteria: All individuals with negative peripheral blood smear or negative rapid kit test for Pf malaria or malaria due to other species of Plasmodium were excluded from the study.

Detection of falciparum malaria: Microscopy and the rapid diagnostic test (RDT; SD Bioline, Korea) for malaria antigen (HRP-2/pLDH) were used to initially screen the samples. The RDT, a quick, qualitative, and differentiating test, finds P. vivax lactate dehydrogenase (pLDH) and Pf’s histidine-rich protein 2 (HRP 2) antigen in human whole blood.

For identifying molecular markers for CQR and artemisinin resistance, thirty samples that were detected positive by RDT, microscopy, and PCR were randomly chosen and subjected to PCR-restriction fragment length polymorphism (RFLP). As a positive control, CQ-sensitive and CQ-resistant Pf (3D7 and Dd2, respectively) DNA were obtained from the Regional Medical Research Centre, Dibrugarh. The target genes selected based on the existing literature included pfcrt-K76T and pfmdr1-N86Y which served as molecular biomarkers for CQR and SNPs in MAL10-688956 and 13-1718319; and Kelch MAL13 propeller gene served as molecular biomarkers for artemisinin resistance or delayed clearance.

Extraction of Plasmodium falciparum (Pf) DNA: Whole blood from Pf-positive participants was collected in EDTA vials and stored at −20°C for DNA isolation. DNA was extracted using the QIAamp DNA Extraction Kit, (Qiagen, Hilden, Germany) as per the manufacturer’s protocol.

PCR for molecular identification of Plasmodium species: Identification of parasite species was done using nested PCR by amplification of 18s rRNA gene specific for each Plasmodium species using specific primers20. Each nest 1 PCR reaction was carried out in a 25 μl reaction volume. PCR was performed in thermal cycler machine (Bio-RAD-C1000, Bio-Rad Laboratories Inc., Hercules, CA, USA). The thermal profile of the nested PCR 1 reaction included initial denaturation at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 60 sec, extension at 72°C for 60 sec and final extension at 72°C for 4 min. PCR product was run in a one per cent agarose gel containing five per cent ethidium bromide and visualized under a gel documentation system using Quantity One Software (Bio-Rad Laboratories Inc., USA). The PCR product size of nest 1 PCR was ~1200 bp (base pair). The nest 1 PCR product was further used for species specific PCR (nest 2) to determine the Plasmodium species using the same thermal profile in PCR reaction. The PCR product size of nest 2 PCR was ~ 205 bp. Primer sequences used in this study are mentioned in Table I.

Table I Primers used for molecular detection of antimalarial drug resistant loci
Primers Sequence (5’- 3’) Reference
Plasmodium Snounou et al20, 1993
rPLU1 TCAAAGATTAAGCCATGCAAGTGA
rPLU5 CCTGTTGTTGCCTTAAACTTC
P. falciparum
FAL 1 TTAAACTGGTTTGGGAAAACCAAATATATT
FAL 2 ACACAATGAACTCAATCATGACTACCCGTC
P. vivax
V1V1 CGCTTCTAGCTTAATCCACATAACTGATAC
V1V2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA
Pfcrt 76 Nest 1 Djimdé et al21, 2001
CRTP1 CCGTTAATAATAAATACACGCAG
CRTP2 GCATGTTACAAAACTATAGTTACC
Nest 2
CRTD1 TGTGCTCATGTGTTTAAACTT
CRTD2 CAAAACTATAGTTACCAATTTT
Pfmdr1-N86Y Lopes et al22, 2002
86_1F ATG GGT AAA GAG CAG AAA GAG
86_1R CGT ACC AAT TCC TGA ACT CAC
Artemisinin Nest 1 Takala-Harrison et al23, 2013
MAL10-EF TGT ATG AAT AGG GAT TGT CC
MAL10-ER GGA AAC ATT TAT GCC ATC AAC
Nest 2
MAL10-IF GAC GAG CAA AAA TTA AAA AAG ATA TAG C
MAL10-IR TTA TAT GTA ATG GGT GAA AAG AAT GTG G
Artemisinin Nest 1
MAL13-EF GAA TAA AGA TGA TAT GAA CGA TG
MAL13-ER CTA ATT AAG GGA TAT GTA GCA TC
Nest 2
MAL13-IF AGG AAG ACA ACG GTG ACG ATC TA
MAL13-IR TTC TAA ACA AAT ACA ACA TTG CAT GAC A
Kelch 13 Ariey et al14, 2014
K13_PCR_F CGGAGTGACCAAATCTGGGA
K13_PCR_R GGGAATCTGGTGGTAACAGC
Nest 1
K13_N1_F GCCAAGCTGCCATTCATTTG
K13_N1_R GCCTTGTTGAAAGAAGCAGA

Pfcrt, Plasmodium falciparum chloroquine resistance transporter; Pfmdr-1, Plasmodium falciparum multidrug drug resistance gene 1

Restriction digestion of pfcrt-K76T: Following amplification of the PCR fragments, polymorphisms in pfcrt gene were assessed by RFLP-PCR by incubation of the corresponding PCR fragments with restriction enzyme ApoI (New England BioLabs, MA, USA). This enzyme cuts the pfcrt-K76 (wild-type) but not the pfcrt-K76T (resistant type)21. Figure 1 shows the PCR-RFLP results of pfcrt-K76T, wherein 145 bp band represents wild type whereas, mutation resulted in 111 and 34 bp bands.

Gel electrophoresis showing DNA bands of wild-type as well as mutated pfcrt-K76T gene after digestion with Apo1 restriction enzyme. Lane 1: 100 bp ladder; Lane 2: blank; Lane 3: ApoI digested Lambda DNA; Lane 4 to Lane 13: pfcrt-resistant Pf. Pf, Plasmodium falciparum.
Fig. 1 Gel electrophoresis showing DNA bands of wild-type as well as mutated pfcrt-K76T gene after digestion with Apo1 restriction enzyme. Lane 1: 100 bp ladder; Lane 2: blank; Lane 3: ApoI digested Lambda DNA; Lane 4 to Lane 13: pfcrt-resistant Pf. Pf, Plasmodium falciparum.

Restriction digestion of pfmdr1-N86Y22: pfmdr1-N86Y was detected by incubation of the corresponding PCR fragments with ApoI (New England BioLabs). The PCR-RFLP of pfmdr1-N86Y amplified a fragment of 504 bp within which the presence of asparagine (N) was determined by the incubation with ApoI (New England BioLabs), originating segments of 255 and 249 bp which resolved as a single band in two per cent agarose gel (Fig. 2).

Agarose gel electrophoresis showing DNA bands of wild-type as well as mutated pfmdr1-N86Y gene after digestion with Apol restriction enzyme. The isolates with DNA fragments of size 249 and 255 bp are the mutated types N86Y, i.e. resistant strains. Lane 1: 100 bp ladder; Lane 2 : negative control; Lane 11: positive control; rest of the lanes contains samples.
Fig. 2 Agarose gel electrophoresis showing DNA bands of wild-type as well as mutated pfmdr1-N86Y gene after digestion with Apol restriction enzyme. The isolates with DNA fragments of size 249 and 255 bp are the mutated types N86Y, i.e. resistant strains. Lane 1: 100 bp ladder; Lane 2 : negative control; Lane 11: positive control; rest of the lanes contains samples.

Restriction digestion of MAL10-688956 and MAL13-1718319 loci23: Enzyme MsiI (New England BioLabs) with NEBuffer 3 was used to digest MAL10-688956 and MAL13-1718319. Appropriate control DNA (3D7 and Dd2) with known pfcrt sequences were used in every PCR-RFLP reactions.

Sequencing of Pf Kelch propeller domain (K13 gene): Ten randomly selected Pf samples from treatment failure cases were further sequenced for K13 gene to detect putative mutations at the K13 locus using published primer sequences14. The thermal profile of the PCR reaction included initial denaturation at 95°C for 15 min, followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 58°C for 120 sec, extension at 72°C for 120 sec and final extension at 72°C for 10 min. The PCR product was purified using High Pure PCR Product Purification kit (Roche Diagnostics, Germany). The sequencing was done in ICMR-Regional Medical Research Centre, Dibrugarh, Assam. Sequencing was carried out in both directions (forward and reverse) using the same primers used for amplification of the gene in SciGenome (www.scigenom.cpm).

Analysis of sequences: Sequences were edited by using the software BioEdit version 7.2.5 (Ibis Biosciences, Carlsbad, CA, USA)24 Both forward and reverse sequences were edited to create a consensus sequence. Edited sequences were aligned against the artimisinin-sensitive (3D7) and artimisinin resistant reference sequences available in the GenBank using Clustal W multiple sequence alignment program. Mutations in the studied sequences were recorded based on these two reference sequences.

Statistical analysis: Data from all the proforma were coded, entered and analyzed using Epi Info 7 (Centre for Disease Control and Prevention, Atlanta, Georgia, USA) and Microsoft excel 7 (Microsoft corporation, Redmond, USA). Chi-square test was performed to assess the significance of molecular markers of drug resistance with various complications and outcomes among the study group. The tests were considered significant if P≤0.05.

Results

Microscopy and RDT were done for a total of 300 fever cases and 69 (23%) cases were found to be positive for malaria. Both microscopy and RDT were positive in 30 (43.4%) cases and only RDT in 24 (34.8%) cases. Of the 69 malaria cases confirmed by microscopy and RDT, 54 were found to be Pf and 15 were found to be P. vivax. Of the 54 falciparum malaria cases, 47 were PCR positive (30 cases both microscopy and RDT positive and 17 only RDT positive). Of the 24 only RDT-positive cases, seven were found to be negative for PCR.

Of the 47 PCR positive samples, 30 were selected randomly for the molecular detection of antimalarial drug resistance genes including those showing treatment failure. The study included falciparum malaria cases from Tinsukia, Sivasagar, Dibrugarh, Dhemaji, Jorhat district of Assam and its neighbouring State Arunachal Pradesh. During the study period, it was seen that in Assam, maximum cases of falciparum malaria occurred in Tinsukia and Sivasagar district (23.33%) followed by Dibrugarh (20%) and Dhemaji district (13.33%). Arunachal Pradesh contributed with 16.66% cases (Fig. 3).

Geographical distribution of the falciparum malaria with drug-resistant molecular biomarkers. Source: ArcGIS software (Desktop version 10.8.1; License EFL931105942).
Fig. 3 Geographical distribution of the falciparum malaria with drug-resistant molecular biomarkers. Source: ArcGIS software (Desktop version 10.8.1; License EFL931105942).

The mean age (mean±standard deviation) of the individuals with drug-resistant pf malaria was 28.9±9.3 (range: 13-45 yr) which included 23/30 (76.6%) males and 7/30 (23.3%) females with a male-to-female ratio of 3.2:1. However, there was no significant difference between the complicated and uncomplicated falciparum malaria cases with respect to age and sex.

All study participants (100%) presented with a headache, 90 per cent presented with fever with chills and rigour while, 80 per cent presented with nausea and vomiting. Other clinical presentations were pallor (60%) and splenomegaly (23%). The most common complication noted in our study was thrombocytopenia (63.33%) followed by jaundice (50%), acute renal failure (46.6%), anaemia (30%) and cerebral malaria (26.6%; Table II). Mortality was seen in 26.6 per cent of the cases in this study.

Table II Complications observed in drug resistant falciparum malaria cases
Complications (n=30) Uncomplicated malaria (n=8), n (%) Complicated malaria (n=22), n (%)
Anaemia 0 (0) 9 (30)
Jaundice 0 (0) 15 (50.0)
Cerebral malaria 0 (0) 8 (26.6)
Thrombocytopenia 2 (6.6) 19 (63.3)
ARF 0 (0) 14 (46.6)
Splenomegaly 1 (3.3) 6 (20.0)
Breathing difficulty 0 (0) 5 (16.6)

WHO criteria was used for differentiation of complicated and uncomplicated malaria12. WHO, World Health Organization; ARF, acute renal failure

Prevalence of the biomarkers of antimalarial drug resistance: In the current study, 29 (96.6%) samples revealed the presence of the pfcrt-K76T (mutant) gene, and one sample (3.3%) had the pfcrt-K76 (wild-type) gene. In addition, 16/19 (84.2%) samples revealed the presence of the pfmdr1-N86Y (mutant) gene, and 3/19 (15.8%) samples revealed the pfmdr1-N86 (wild-type) gene. The target SNPs at the MAL10-688956 and MAL13-1718319 loci did not show any mutations (Table III). Sixteen samples (16/30, 53.3%) showed the presence of both pfcrt-K76T and pfmdr1-N86Y genes. Sequence analysis of Kelch-13 propeller gene showed the presence of a novel mutation at amino acid position 675 where a point mutation was found to change amino acid alanine (A) to valine (V). The mutation observed in this study was unusual in contrast to the commonly detected mutations of this gene.

Table III Prevalence of the biomarkers of antimalarial drug resistance among the study population
Biomarkers Wild-type, n (%) Mutant, n (%) Total
Pfcrt-K76T 1 (3.3) 29 (96.6) 30
Pfmdr1-N86Y 3 (15.8) 16 (84.2) 19
MAL10-688956 30 (100) 0 30
MAL13-1718319 30 (100) 0 30

Prevalence of the biomarkers of antimalarial drug resistance according to demographic profile: Among the complicated cases of falciparum malaria, it was found that pfcrt-K76T and pfmdr1-N86Y were present in individuals across age groups, but majority of the individuals (85.7%) having pfcrt-K76T mutation were noted in the age group 40-49 yr followed by 83.3 per cent in the age group 10-19 yr. Majority of the individuals (62.5%) having pfmdr1-N86Y mutation were noted in the age group 20-29 yr followed by 50 per cent in the age group 10-19 yr. pfcrt-K76T/pfmdr1-N86Y was found in 18/13 (78.3/56.5%) of the males and 4/1 (57.1/14.3%) of the females, respectively. Among the uncomplicated cases, 37.5 per cent with pfcrt-K76T were found between the age of 20-29 yr followed by 22.2 per cent between the age of 30-39 yr. pfcrt-K76T/pfmdr1-N86Y was found in 5/0 (21.7%/0) male and 3/2 (42.8%/28.5%) females, respectively. However, no significant difference was found in the prevalence of biomarkers with respect to age and sex among the complicated and uncomplicated cases (P=0.859 vs. 0.360 and 0.350 vs. 0.151, respectively).

Prevalence of the biomarkers of antimalarial drug resistance according to clinical presentation: The prevalence of the drug-resistant biomarkers pfcrt-K76T/pfmdr1-N86Y among uncomplicated and complicated malaria cases was 87.5/25 and 96.6/84.2 per cent, respectively. However, no significant association was found between these (P=0.350). Among the complicated malaria cases, pfcrt-K76T vs. pfmdr1-N86Y mutation was found in 100 vs. 80 per cent of cases who suffered from jaundice, 100 vs. 64 per cent of cases with acute renal failure, 100 vs. 52.4 per cent of cases with thrombocytopenia, 100 vs. 50 per cent of cases suffered from cerebral malaria and 100 vs. 33.3 per cent of cases who suffered from anaemia. No difference was observed between different molecular biomarkers with regard to the presentation of complications (P=0.878). Among the uncomplicated malaria cases, only thrombocytopenia was seen in 25 per cent of cases and all of them harboured pfcrt-K76T mutation, but pfmdr1-N86Y mutation was not seen. The individuals with falciparum malaria were treated with artemisinin combination therapy (ACT) comprising artemether and lumefrantine and primaquine.

There were two types of outcomes - expired and improved. All of the individuals who died had high parasite counts, followed by cerebral malaria, which was present in 87.5 per cent individuals, related anaemia in 44.4 per cent, ARF in 42.8 per cent, thrombocytopenia in 38.9 per cent, and jaundice in 33.3 per cent of study participants. A total of 95.4 and 54.5 per cent of the improved patients were discovered to have the pfcrt-K76T and pfmdr1-N86Y mutations, respectively. All of the expired cases were found to have the pfcrt-K76T gene and 50 per cent of these had the pfmdr1-N86Y gene. However, no significant difference was found between the presence of molecular biomarkers with respect to the outcome of the cases (P=0.851).

Among the recovered cases, jaundice was present in a majority (10/15, 66.6%) followed by thrombocytopenia in 13/21 (61.9%), ARF in 8/14 (57.1%), anaemia in 5/9 (55.5%) and cerebral malaria in 1/8 (12.5%). A significant association was found among the various complications and their outcomes (P<0.011, Chi-square test).

Fever failed to resolve within 72 h in 12 participants, of which 10 were complicated. All the 10 participants who had multiorgan dysfunction score showed the presence of pfcrt-K76T mutation which was suggestive of treatment failure. Ten randomly selected samples from these 12 participants were processed further for detection of Kelch-13 gene, and one showed the presence of Kelch-13 gene, who, however, died during treatment. The parasite count on day 3 of these 12 participants was >100,000/μl. This was not so severe among the uncomplicated cases and antimalarials seemed effective despite the presence of pfcrt-K76T mutation in both complicated and uncomplicated cases.

The sequences were deposited in GenBank and the accession numbers are OK665935, OK665936, OK665937, OK665938, OK665939, OK665940, OK665941, OK665942 and OK665943.

Discussion

In India, the first case of Pf resistance to CQ, the most affordable and widely used antimalarial medication, was recorded in 1973 from Diphu in the Karbi-Anglong district of Assam25.

In the present study, out of the 30 samples, 96.6 per cent showed the presence of pfcrt-K76T (mutant) gene and 3.3 per cent had pfcrt-K76 (wild-type) gene, 84.2 per cent samples showed the presence of pfmdr1-N86Y (mutant) gene and 15.8 per cent showed pfmdr1-N86 (wild-type) gene. 72.1 per cent prevalence of pfcrt-K76T mutation compared to pfmdr1-N86Y mutation (41.8%) was found in Sonitpur district of Assam in earlier studies26. Ninety nine per cent of isolates with mutant pfcrt genotype (76T) over 68 per cent with mutant pfmdr1 genotype (86Y) was found in north Lakhimpur and Hailakandi17. Similar to a previous study by Ranjit et al27, in the present study, the prevalence of the drug-resistant biomarkers pfcrt-K76T/pfmdr1-N86Y among uncomplicated and complicated malaria cases was 87.50/25 and 96.6/84.2 per cent, respectively. In the present investigation, it was found that pfcrt-76T and pfmdr1-86Y, either separately or together, were related to the emergence of severe complications. Results from the correlation between pfmdr1 genotypes and CQR have frequently been inconclusive. Different geographical regions have shown the relationship of CQR with pfcrt-K76T and, to a lesser extent, pfmdr1-N86Y in Pf isolates27-31. K76T mutations were found in all cases that did not respond to CQ and 96 per cent of individuals who recovered with CQ according to a molecular analysis on 274 Indian Pf isolates, demonstrated lack of a correlation between the K76T mutation and clinical cure32. But in their analysis, a significant association between the K76T mutation and the in vitro response to CQ Pf was found. Pfmdr1 gene alleles demonstrated a strong association but incomplete correlation with CQR. The existence of pfcrt mutations, however, may not always signal treatment failure and CQR in vivo, according to certain studies32,33. In 2007, artesunate-sulfadoxine-pyrimethamine (AS+SP) was chosen as the first line antimalarial for areas with known CQR and high risk districts34. AS+SP has been the suggested first line antimalarial in India since 201035. Nationwide sentinel sites were established in 2009 to track antimalarial drug resistance36. Four districts included in the study and Arunachal Pradesh were considered ‘areas identified for use of ACT combination (AS+SP) for treatment of Pf malaria under this programme.

The first report of SP resistance was again reported from the Karbi-Anglong district of Assam in 197937. Drug-resistant studies carried out in Assam during 2006 and 2007 identified 12.6 per cent treatment failure in SP, accompanied by resistant mutations in dhfr and dhps17. AS+SP efficacy studies carried out in three NE States (Mizoram, Tripura and Arunachal Pradesh) in 2012 revealed treatment failure rates of >10 per cent, necessitating a change in drug policy38. The resistance to the artemisinin derivatives and the resulting failure of ACT are threatening all major gains made in malaria control. Although, Government of India supplied ACT (AS+SP) combination for the treatment of malaria; due to the occurrence of high grade of sulfadoxine-pyrimethamine resistance malarial parasite found in NE States of India, National Drug Policy for Malaria Cases introduced artesunate-lumefantrine (ACT-AL) in NE States in 201339. In the present study, all the cases were treated with artemether-lumefantrine (AL).

In the present study, no mutation was detected for the target SNPs at positions MAL10-688956 and MAL13-1718319 which were believed to act as a marker for delayed parasite clearance in southeast Asian region. Previously, eight and three per cent of isolates, predominantly from Cambodia and Thailand, were found to have two SNPs at genomic locations MAL10-688956 and MAL13-1718319, which were associated to delayed clearance of parasites following ACT40. In models of parasite clearance half-life, two SNPs: one on chromosome 10 (MAL10-688956) and one on chromosome 13 (MAL13-1718319) achieved genome-wide significance16. Sequencing of the Kelch-13 propeller gene showed the presence of a novel mutation at amino acid position 675. As this mutation confers to a change in the amino acid from alanine (A) to valine (V), its role in the development of artemisinin resistance will be interesting to know. This novel mutation in K13 gene has not been reported earlier from NE India and its role in artemisinin resistance should be explored further.

The K13 gene showed 12 mutations in 123 isolates, with C580Y being the most common mutation and being detected in western Cambodia, Myanmar, and Vietnam41. A comparative analysis of the molecular surveillance data of various studies done in NE India is depicted in Table IV .

Table IV Prevalence of different anti-malarial drug resistance locus in P. falciparum isolates from north-east India using various molecular methods
Drug-resistant marker studied District State Sample collection year Prevalence of resistance (%) Reference
PCR and sequencing
Pfcrt (chloroquine) Different districts Mizoram 2015-2017 58.5 Zomuanpuii et al42, 2020
Pfmdr-1 (multidrug resistance) 48.7
Pfcrt (chloroquine) North Tripura and Dhalai district Tripura 2015 87 Patgiri et al43, 2019
Pfmdr-1 (multidrug resistance) 12.5
PfK-13 (Kelch 13 propeller) No polymorphism in PfK-13 observed
Pfdhps and Pfdhfr (sulphadoxine/pyrimethamine) Arunachal Pradesh 2013 Pfdhfr codon 51-100, codon 59-100, codon 108-100 and codon 164-100% Pfdhps ranged from 60 to 19.5% including 3 novel mutations at codons 404, 453 and 498 Sarmah et al44, 2017
Pfdhps (sulphadoxine) Arunachal Pradesh, Assam and Tripura 2014-2015 Mutation at 437 codon was the most prevalent (74.8%) Das et al45, 2016
Pfmdr1 (multidrug resistance) Belonia Tripura 2007-2009 52.6 Goswami et al47, 2014
Nested PCR and RFLP
Pfdhps and Pfdhfr (sulphadoxine/pyrimethamine) Chirang Assam 2012-2013 93.62 Sharma et al46, 2015
Pfcrt (chloroquine) North Lakhimpur and Hailakandi Assam 2006-2007 99 Mohapatra et al17, 2014
Pfmdr-1 (multidrug resistance) 68
Pfdhps and Pfdhfr (sulphadoxine/pyrimethamine) Pfdhfr codon 108 showed 100 mutation while at Pfdhps locus mutation at 437 codon was the most prevalent (59.5%)
Pfcrt (chloroquine) Belonia Tripura 2007-2009 100 Goswami et al47, 2014
Pfcrt (chloroquine) Sonitpur Assam 2007-2010 72.13 Goswami et al26, 2014
Pfmdr1 (multidrug resistance) 41.79
Nested PCR, RFLP and sequencing
Pfcrt-K76T (chloroquine resistant mutant) Tinsukia, Sivasagar, Dibrugarh, Dhemaji, Jorhat Assam 2015-2016 96.6 Present study
Pfcrt-K76 (wild type) 3.3
Pfmdr1-N86Y (multidrug resistant mutant) 84.2
Pfmdr1-N86 (wild type) 15.8
PfK13 (Kelch-13 propeller) In one case (out of 10) Kelch 13 propeller gene showed presence of a novel mutation at amino acid position 675

Pfcrt, Plasmodium falciparum chloroquine resistance transporter; Pfmdr1, Plasmodium falciparum multidrug-resistant gene 1; PfK-13, Plasmodium falciparum Kelch 13; PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism

One of the limitation of the study was that, our study could not rule out possibility of the false positive results given by RDT in some patients. Furthermore, Assam is an endemic State for malaria and the people used to take antimalarial drugs routinely for any febrile illness in remote areas and a major drawback of the RDT targeting HRP2 is that, parasite HRP2 may persist in the circulation even after parasite clearance and a major cause of false-positive results.

The present study concludes that CQ exerts major selective forces on the pfcrt and pfmdr1 genes, whereby the presence of pfcrt-K76T and pfmdr1-N86Y in parasites of this region has been selected by CQ pressure. The present study also found occurrence of high level of CQR in the study area. Accelerated multidrug resistance marker acquisition suggests that Pf is rapidly evolving towards a greater degree of fitness against antimalarials. Novel mutations at codon position 675 in Pf K13 gene was detected in an individuals from Arunachal Pradesh. In Assam, no mutation was detected for the target SNPs at positions MAL10-688956 and MAL13-1718319 which were believed to act as a marker for delayed parasite clearance in southeast Asian region, indicating that the use of ACT is still effective for treatment of Pf cases in Assam. Although there is no report of artemisinin resistance in this region, the therapeutic efficacy of this drug needs to be monitored closely. The presence of a novel mutation in the K13 gene, whose role in artemisinin resistance is yet to be established, is an interesting observation and a matter of concern. The role of this novel mutation in regard to artemisinin resistance is important to explore in future. Hence, continuous monitoring with clinical efficacy trials along with molecular surveillance can facilitate to monitor drug sensitivity which helps confer early warning signal of an impending ACT resistance.

Financial support and sponsorship

The study was suppoerted by the Department of Biotechnology, Government of India, New Delhi, and DBT Nodal Centre, Tezpur (Sanction no. BT/Med/15/Vision-NER/2011).

Conflicts of interest

None.

References

  1. . Estimation of true malaria burden in India. A profile of National Institute of Malaria Research. New Delhi, India: NIMR; . p. :91-9.
  2. , , , . India's invisible malaria burden. Lancet. 2010;376:1716-7.
    [Google Scholar]
  3. , , . Malaria: Current strategies for control in India. Indian J Med Spec. 2013;4:59-66.
    [Google Scholar]
  4. , . Drug resistance in malaria. Br Med Bull. 1998;54:703-15.
    [Google Scholar]
  5. , . Malaria. In: , , eds. Manson's tropical diseases (22nd ed). The Netherlands: Elsevier; . p. :1201-300.
    [Google Scholar]
  6. , , , . History, dynamics, and public health importance of malaria parasite resistance. Clin Microbiol Rev. 2004;17:235-54.
    [Google Scholar]
  7. , , , , , . Pyrimethamine and proguanil resistance-conferring mutations in Plasmodium falciparum dihydrofolate reductase: Polymerase chain reaction methods for surveillance in Africa. Am J Trop Med Hyg. 1995;52:565-8.
    [Google Scholar]
  8. , , , , , , . Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol Cell. 2000;6:861-71.
    [Google Scholar]
  9. , , , . Chloroquine resistance in Plasmodium falciparum malaria parasites conferred by pfcrt mutations. Science. 2002;298:210-3.
    [Google Scholar]
  10. , , . Contribution of the pfmdr1 gene to antimalarial drug-resistance. Acta Trop. 2005;94:181-90.
    [Google Scholar]
  11. , , , , , , . Surveillance of antimalarial resistance molecular markers in imported Plasmodium falciparum malaria cases in Anhui, China, 2012-2016. Am J Trop Med Hyg. 2018;98:1132-6.
    [Google Scholar]
  12. . Guidelines for the Treatment of Malaria (3rd ed). Geneva: WHO; .
  13. , , , , , , . Evidence of artemisinin-resistant malaria in western Cambodia. N Engl J Med. 2008;359:2619-20.
    [Google Scholar]
  14. , , , , , , . A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50-5.
    [Google Scholar]
  15. , , , , , , . A major genome region underlying artemisinin resistance in malaria. Science. 2012;336:79-82.
    [Google Scholar]
  16. , , , , , , . Genetic loci associated with delayed clearance of Plasmodium falciparum following artemisinin treatment in Southeast Asia. Proc Natl Acad Sci U S A. 2013;110:240-5.
    [Google Scholar]
  17. , , , , , , . Molecular evidence of increased resistance to anti-folate drugs in Plasmodium falciparum in North-East India: A signal for potential failure of artemisinin plus sulphadoxine-pyrimethamine combination therapy. PLoS One. 2014;9:e105562.
    [Google Scholar]
  18. , , , , , , . Multi-drug resistant Plasmodium falciparum malaria in Assam, India: timing of recurrence and anti-malarial drug concentrations in whole blood. Am J Trop Med Hyg. 2003;69:555-7.
    [Google Scholar]
  19. , , , , . Prevalence of multiple drug-resistant Plasmodium falciparum malaria cases in Northeast India. Indian J Med Microbiol. 2017;35:140-2.
    [Google Scholar]
  20. , , , , , . Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol. 1993;58:283-92.
    [Google Scholar]
  21. , , , , , , . A molecular marker for chloroquine-resistant falciparum malaria. N Engl J Med. 2001;344:257-63.
    [Google Scholar]
  22. , , , , , , . Molecular characterisation of drug-resistant Plasmodium falciparum from Thailand. Malar J. 2002;1:12.
    [Google Scholar]
  23. , , , , , , . Genetic loci associated with delayed clearance of Plasmodium falciparum following artemisinin treatment in Southeast Asia. Proc Natl Acad Sci U S A. 2013;110:240-5.
    [Google Scholar]
  24. , . BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucl Acids Symp Ser. 1999;41:95-8.
    [Google Scholar]
  25. . National Vector Born Disease Control: Drug resistance. Available from: https://nvbdcp.gov.in/index1.php?lang=1&level=1&sublinkid=5811&lid=3799
  26. , , , , , , . High prevalence of pfcrt K76T and mdr1 N86Y mutations in Sonitpur district of Assam, India. J Parasit Dis. 2014;38:250-4.
    [Google Scholar]
  27. , , , , , . Chloroquine-resistant P. falciparum parasites and severe malaria in Orissa. Curr Sci. 2009;96:1608-11.
    [Google Scholar]
  28. , , . The evolution of multiple drug resistance in malaria parasites. Trans R Soc Trop Med Hyg. 1998;92:188-95.
    [Google Scholar]
  29. , , , , , , . Linkage disequilibrium between two chromosomally distinct loci associated with increased resistance to chloroquine in Plasmodium falciparum. Parasitology. 2000;121:1-7.
    [Google Scholar]
  30. , , , , , , . High-level chloroquine resistance in Sudanese isolates of Plasmodium falciparum is associated with mutations in the chloroquine resistance transporter gene pfcrt and the multidrug resistance Gene pfmdr1. J Infect Dis. 2001;183:1535-8.
    [Google Scholar]
  31. , , , , , , . Gambian children successfully treated with chloroquine can harbor and transmit Plasmodium falciparum gametocytes carrying resistance genes. Am J Trop Med Hyg. 2002;67:578-85.
    [Google Scholar]
  32. , , , , , , . Prevalence of the K76T mutation in the pfcrt gene of Plasmodium falciparum among chloroquine responders in India. Acta Trop. 2003;87:287-93.
    [Google Scholar]
  33. , , , , , , . Mutant pfcrt “SVMNT” haplotype and wild type pfmdr1 “N86” are endemic in Plasmodium vivax dominated areas of India under high chloroquine exposure. Malar J. 2012;11:16.
    [Google Scholar]
  34. , , , , , , . Antimalarial drug resistance of Plasmodium falciparum in India: Changes over time and space. Lancet Infect Dis. 2011;11:57-64.
    [Google Scholar]
  35. . . National Drug Policy on Malaria. Available from: https://nvbdcp.gov.in/Doc/drug-policy-2010.pdf
  36. , , , , , , . Monitoring antimalarial drug resistance in India via sentinel sites: Outcomes and risk factors for treatment failure, 2009-2010. Bull World Health Organ. 2012;90:895-904.
    [Google Scholar]
  37. , , , , . Pyrimethamine in combination with sulfadoxine or sulfalene in P. falciparum infected cases in India. Indian J Malariol. 1981;18:109-16.
    [Google Scholar]
  38. , , , , , , . Declining efficacy of artesunate plus sulphadoxine-pyrimethamine in northeastern India. Malar J. 2014;13:284.
    [Google Scholar]
  39. . . National Drug Policy on Malaria. Available from: https://nvbdcp.gov.in/Doc/National-Drug-Policy-2013.pdf
  40. , , , , , . Global distribution of polymorphisms associated with delayed Plasmodium falciparum parasite clearance following artemisinin treatment: Genotyping of archive blood samples. Parasitol Int. 2015;64:267-73.
    [Google Scholar]
  41. , , , , , , . Independent emergence of artemisinin resistance mutations among Plasmodium falciparum in Southeast Asia. J Infect Dis. 2015;211:670-9.
    [Google Scholar]
  42. , , , , , , . Epidemiology of malaria and chloroquine resistance in Mizoram, northeastern India, a malaria-endemic region bordering Myanmar. Malar J. 2020;19:95.
    [Google Scholar]
  43. , , , , , , . Characterization of drug resistance and genetic diversity of Plasmodium falciparum parasites from Tripura, Northeast India. Sci Rep. 2019;9:13704.
    [Google Scholar]
  44. , , , , , , . Antifolate drug resistance: Novel mutations and haplotype distribution in dhps and dhfr from Northeast India. J Biosci. 2017;42:531-5.
    [Google Scholar]
  45. , , , , . Evidence of triple mutant Pfdhps ISGNGA haplotype in Plasmodium falciparum isolates from North-east India: An analysis of sulfadoxine resistant haplotype selection. Genom Data. 2016;10:144-50.
    [Google Scholar]
  46. , , , , , , . Genetic polymorphisms associated with sulphadoxine-pyrimethamine drug resistance among Plasmodium falciparum field isolates in malaria endemic areas of Assam. J Postgrad Med. 2015;61:9-14.
    [Google Scholar]
  47. , , , , , , . Pfcrt mutant haplotypes may not correspond with chloroquine resistance. J Infect Dev Ctries. 2014;8:768-73.
    [Google Scholar]
Show Sections
Scroll to Top