Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
View/Download PDF

Translate this page into:

Practice: Original Article
158 (
4
); 432-438
doi:
10.4103/ijmr.ijmr_3148_21

Modulation of semaphorin 3C & 4D expression in cancerous tissues from individuals with laryngeal squamous cell carcinoma

Department of Immunology, School of Medicine, Kerman University of Medical Sciences, Kerman, Iran
Research Center of Otolaryngology Head & Neck Surgery, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
Department of Otolaryngology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
Department of Immunology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
Shiraz Institute for Cancer Research, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran
Department of Tissue Engineering & Applied Cell Sciences, School of Advanced Medical Sciences & Technologies, Shiraz University of Medical Sciences, Shiraz, Iran
Contributed equally

For correspondence: Dr Abdollah Jafarzadeh, Department of Immunology, School of Medicine, Kerman University of Medical Sciences, Kerman, Iran e-mail: jafarzedeh14@gmail.com

Licence
This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.
Disclaimer:
This article was originally published by Wolters Kluwer - Medknow and was migrated to Scientific Scholar after the change of Publisher.

Abstract

Background & objectives:

Semaphorins were initially characterized as axon guidance factors but were subsequently implicated in the regulation of immune responses, angiogenesis, organ formation and a variety of other physiological and developmental functions. Various semaphorins enhance or inhibit tumour progression through different mechanisms. The objective of this study was to assess the expression of various semaphorins and vascular endothelial growth factor (VEGF) gene transcripts as well as the serum level of Sema3A in individuals with laryngeal squamous cell carcinoma (LSCC).

Methods:

Tissue expression of Sema3A, Sema3C, Sema4D, Sema6D and VEGF was determined in both tumour tissues and tissues around the tumour from 30 individuals with pathologically confirmed LSCC using quantitative real-time PCR. Furthermore, the serum level of Sema3A in these individuals was assessed using enzyme-linked immunosorbent assay.

Results:

Sema3C gene transcript showed a significant increase (P=0.001), while Sema4D was observed with a significant decrease in tumour samples compared to non-tumoural tissues (P≤0.01). The expression of the Sema3C gene was found to be associated with the stage of LSCC tumour as it was statistically significant for tumours with stage IV (P<0.01). The serum level of Sema3A was not found to be significant between cases and controls.

Interpretation & conclusions:

Increased expression of Sema3C but decreased expression of Sema4D in tumour tissue of LSCC may introduce these two growth factors as crucial mediators orchestrating tumour growth in individuals with LSCC. This result could open a new vision for the treatment of this malignancy.

Keywords

Angiogenesis
laryngeal squamous cell carcinoma
metastasis
semaphorins
vascular endothelial growth factor

Semaphorins are mostly known for their importance in repulsive axon guidance but are now recognized as crucial regulators of morphogenesis and homeostasis in various tissues1. These molecules and their receptors are associated with sensitivity to cytosolic signalling in various diseases, such as schizophrenia, neurodegenerative diseases and especially cancer1. Various semaphorins are reported to enhance or inhibit tumour progression by promoting or inhibiting tumour angiogenesis, metastasis and tumour cell survival2. Squamous cell carcinoma (SCC) is the most common type of head-and-neck cancer, and the fifth-most common cancer in the world3. This malignancy is multifactorial and common treatment strategies consist of surgery, chemotherapy and/or radiotherapy4,5. In more than half of the individuals with locally advanced head-and-neck cancer there is recurrence, and the prognosis of these individuals is poor3.

Abnormal angiogenesis is one of the pivotal mechanisms responsible for tumour development and progression through different mediators6. Vascular endothelial growth factor (VEGF) has been identified as a major enhancer of angiogenesis and its signals are transmitted by two tyrosine kinase receptors (VEGFR-1 and VEGFR-2) binding to all forms of VEGFs7. Such receptors were first identified in endothelial cells and were called neuropilin-1 and neuropilin-2. Since neuropilins were formerly known as class 3 semaphorin receptors, these could modulate angiogenesis induced by VEGF. Class 3 semaphorins (Sema3A, Sema3B, Sema3C, Sema3D and Sema3E) can act as potent inhibitors of angiogenesis8. Furthermore, there are reports suggesting that, long-term stimulation of endothelial cells by Sema3A and Sema3F may lead to apoptosis being a part of the anti-angiogenic effect of semaphorins9,10. There are reports concerning the role as well as expression of different semaphorin family members in progression of various cancer types. Hence, studying the properties of this protein family may be beneficial to the development of anti-angiogenic therapies and the prognosis of cancer11. Most class 3 semaphorins (Sema3A, 3B, 3D, 3F and 3G) prevent cell migration. However, Sema3C reportedly enhances tumour cell migration and is highly expressed in metastatic tumour cells12,13. Upregulation of the Sema4D has been indicated in individuals with chronic lymphocytic leukaemia and is thought to lead to cell growth and survival in B cell acute lymphocytic leukaemia14,15. Sema4D can potentiate the invasive ability of pancreatic cancer cells and its high expression is associated with a higher amount of lymph angiogenesis, the lymphatic vessel invasion and the occurrence of lymph node metastases16,17. This semaphorin was significantly associated with an unfavourable outcome in cervical cancer patients17. Sema6D was associated with more invasive behaviour and enhanced metastatic potential in breast cancer18. Upregulation of Sema6D was also indicated in gastric carcinoma representing that this semaphorin plays an important role in the development of gastric carcinoma19,20.

Semaphorins can influence tumour progression through influencing VEGF-induced angiogenesis. For instance, SEMA4D contributed to the tumour progression and poor prognosis in cervical cancer through increasing VEGF expression21. Sema4D has been shown to cooperate with VEGF to enhance tumour progression and angiogenesis in oral squamous cell carcinoma, ovarian cancer, colorectal cancer and head-and-neck SCC21.

In order to assess the role of semaphorins in tumour progression or suppression, this study undertook to investigate the expression of Sema3A, 3C, 4D, 6D and VEGF gene transcripts as well as the serum level of Sema3A in individuals with laryngeal SCC (LSCC).

Material & Methods

Study participants: In this study, 60 individuals with LSCC who underwent surgery at Khalili Hospital of Shiraz University of Medical Sciences, Iran were selected for enzyme-linked immunosorbent assay (ELISA) (group 1) to determine serum Sema3A levels. The LSCC diagnosis was made according to the laryngoscopy analysis and pathological findings on biopsy samples collected and viewed under a microscope by a pathologist22. Tumour tissues and the surrounding healthy tissue samples (as controls), were collected from 30 of the participants (group 2) during surgery (before starting treatment) to determine the mRNA expression of semaphorins using quantitative real-time PCR (qPCR). The corresponding adjacent normal tissues were 3 mm apart from tumour tissues. Individuals with pathology except SCC and those undergoing radiotherapy and chemotherapy were excluded from the study.

All participants provided written informed consent before enrolling in the study. This study was approved by the Ethics Committee of Shiraz University of Medical Sciences, Iran. All procedures were set up and done at the Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences.

The sample size was determined by G*Power SSC software 3.1 (designed by Erdfelder, Faul, & Buchner, 2007) based on the previous studies (α=0.05, power=80% and standard deviation=6).

RNA extraction and cDNA synthesis: Tissue samples were cut into small pieces and total RNA was extracted using RNX plus (Cinagene, Iran). cDNA was synthesized from the extracted RNA using the cDNA synthesis kit according to the manufacturer’s instructions (Fermentas, Finland).

Quantitative real-time PCR (qPCR): Human Sema3A, 3C, 4D, 6D and VEGF gene transcripts were amplified by thermal cycler (ABI, USA) and using appropriate primers. Each PCR reaction was carried out in a final volume of 20 μl containing 5 μl cDNA, 10 μl of 2X SYBR Green Master Mix (ABI, USA), 0.3 μl of each forward and reverse primers (Supplementary Table) and 4.4 μl DEPC-treated water. Thermal cycling for all the genes was initiated with a denaturation step at 95°C for 10 min, followed by 50 cycles with the subsequent programme for each cycle: 95°C for 15 s, 57°C for 30 s and 60°C for 1 min. Quantitative values were obtained from the threshold cycle (Ct), where the increase in the fluorescent signal is associated with an exponential increase in the product of qPCR. The expressions of Sema3A, 3C, 4D, 6D and VEGF mRNA were determined using the 2-ΔΔCt method and defined as fold change22. The β-actin housekeeping gene was used for target gene expression normalization23.

Supplementary Table The sequences of forward and reverse primers used to detect the expression of semaphorins and vascular endothelial growth factor (VEGF) mRNA in the samples
Gene of interest Sequence 5’→3’
SEMA3A Forward primer: TTCCACTAAGCAGCAACAACTA
Reverse primer: CAACACTCAGCACACGCTTT
SEMA3C Forward primer: ACCCACTGACTCAATGCAGAGG
Reverse primer: CAGCCACTTGATAGATGCCTGC
SEMA4D Forward primer: GGAGGAAGGCGTGGGAAAG
Reverse primer: GTGGCAGCAGGGTCTTGTT
SEMA6D Forward primer: CATCCCCTGATGGACTCTGC
Reverse primer: TCAGTCTGTACCTGACCCGA
VEGF Forward primer: CCTTGCCTTGCTGCTCTACC
Reverse primer: TGATGATTCTGCCCTCCTCCTT
B-actin Forward primer: ATGCGTCAGAAGGATTCCTATGT
Reverse primer: TCAGGAGGAGCAATGATCTTGA

SEMA, semaphorins

Enzyme-linked immunosorbent assay (ELISA): The protein expression of SEMA3A in the serum of 60 individuals with LSCC and 30 normal age- and sex-matched individuals was evaluated using an ELISA kit (Crystal Day Biotech, China) as per the manufacturer’s protocol. At first, 100 μl of standard (3, 6, 12, 24, 48 and 96 ng/ml) and 40 μl of serum samples were added to the wells then 10 μl of biotinylated anti-Sema3A was added to each well. A volume of 50 μl of streptavidin-conjugated horseradish peroxidase (HRP) enzyme was then added to each well and incubated at 37°C for 90 min and then washed five times. Next, 50 μl of each chromogen A and B solution were added and incubated at 37°C for 10 min, then the enzymatic reaction was stopped using 50 μl of stop solution, and the absorbance was measured at 450-620 nm in a microplate spectrophotometer.

Statistical analysis: The intergroup differences in variables were estimated using Mann–Whitney and Kruskal–Wallis H nonparametric tests. The data of ELISA assessment were analyzed using Student’s t test. All data analyses were carried out using the Statistical Package for the Social Science (SPSS) version 21 software (IBM Corp, Armonk, USA), and relative expression was plotted and assessed by Prism 6 software (Inc., USA). Finally, P<0.05 was considered statistically significant.

Results

Demographic information of participants: Demographic information of the cases is presented in Table. The mean age was 60.5±18.6 yr (range: 40-79 yr) for group 1 (ELISA test) and 60±19.5 years (40-79 yr) for group 2 (qPCR). Regarding tumour size, the higher percentage was referred to T2 (2-4 cm) (48.4% in group 1 and 43.3% in group 2). The majority of the participants in either groups emerged with advanced clinical stage (stages III and IV) as it was 86.7 per cent in group 1 and 80 per cent in group 2 (Table).

Table Demographic information of individuals who participated in the study
Study parameters Participants used for ELISA (Group 1), n=60, n (%) Participants used for qPCR (Group 2), n=30, n (%)
Age (mean±SD, yr) 60.5±18.6 60±19.5
Tumour size
T1 (≤2 cm) 10 (16.6) 7 (23.3)
T2 (2-4 cm) 29 (48.4) 13 (43.3)
T3 (≥4 cm) 21 (35) 10 (33.4)
Stage
II (early stage) 6 (10) 4 (13.3)
III or IV (advanced clinical stage) 52 (86.7) 24 (80)
Unidentified 2 (3.3) 2 (6.7)
Total 60 (100) 30 (100)

ELISA, enzyme-linked immunosorbent assay; qPCR, quantitative real-time polymerase chain reaction; SD, standard deviation

Relative gene expression of semaphorins: The mRNA expression of Sema3A and Sema6D was lower in tumour tissues compared to controls, although their differences were not significant. Sema4D was expressed with a 6-fold significant decrease in tumour samples compared to healthy tissues (P=0.0011). On the contrary, the mRNA expression of Sema3C showed 6.3-fold significant increase in tumour samples (P=0.001). The mRNA expression of VEGF was higher in tumour tissues compared to controls, although the difference was not significant (Fig. 1).

Transcripts level of semaphorins in LSCC individuals. Data are presented as median. Data are presented as fold change and β-actin housekeeping gene was used for gene expression normalization. LSCC, laryngeal squamous cell carcinoma; sema, semaphorins; VEGF, vascular endothelial growth factor (P**<0.01 vs. non-cancerous tissue).
Fig. 1
Transcripts level of semaphorins in LSCC individuals. Data are presented as median. Data are presented as fold change and β-actin housekeeping gene was used for gene expression normalization. LSCC, laryngeal squamous cell carcinoma; sema, semaphorins; VEGF, vascular endothelial growth factor (P**<0.01 vs. non-cancerous tissue).

Semaphorins gene expression and tumour stage of laryngeal squamous cell carcinoma (LSCC): The expression of the Sema3C gene was found to be associated with the stage of LSCC tumour. The expression of this gene was amplified by increasing the stage of the disease as this difference was significant for tumours with stage IV (P=0.0038). Sema4D showed a significant negative association with the stage as it showed the less expression in individuals with stage IV (P=0.0187) compared with stage II and III and non-tumoural tissues. There were no significant differences between different stages of LSCC regarding the VEGF expression; however, the intra-tumoural expression of VEGF showed 2.4-fold higher expression in tumour tissues with pathological stage IV compared with adjacent normal tissues (Fig. 2).

Semaphorins gene expression and tumour stage of LSCC. Data are presented as median. (P*<0.05, **<0.01 vs. non-cancerous).
Fig. 2
Semaphorins gene expression and tumour stage of LSCC. Data are presented as median. (P*<0.05, **<0.01 vs. non-cancerous).

Serum concentration of Sema3A: The mean serum concentrations of Sema3A were lower in the cases (19.05±2.1 pg/ml) in comparison with healthy controls (25.62±4.0 pg/ml) though not significant (P>0.05) (Fig. 3).

Sema3A serum concentration in cases and healthy participants. Data are shown as mean ± SEM. SEM, standard error of the mean.
Fig. 3
Sema3A serum concentration in cases and healthy participants. Data are shown as mean ± SEM. SEM, standard error of the mean.

In addition, with increasing age, serum concentration of Sema3A increased, as the highest concentration was seen in participants in the age range of 70-79 yr. No relationship was observed between the clinicopathological features of the study participants and serum concentration of Sema3A (P>0.05).

Discussion

Semaphorins are known as both proangiogenic and anti-angiogenic mediators depending on the expression of their various receptors, neuropilins and plexins, in different disease conditions8. As various semaphorin members are important in the regulation of tumour growth and progression, we assessed the expression of different semaphorins as well as the relationship between their expression and the degree of tumour progression in individuals with LSCC. The anti-angiogenic activity of Sema3A justifies its inhibitory effect on the development of both haematological and solid malignancies such as multiple myeloma and prostate and breast cancers, respectively8. Sema3A is capable of directly affecting the behaviour of tumour cells and inhibits tumour progression, for instance, through regulating the phosphorylation and nuclear translocation of phosphatase and tensin homolog and the activation of the forkhead transcription factor FOXO-3a24. On the other hand, there are reports showing tumour-promoting effects of Sema3A in hepatocellular carcinoma, glioblastoma multiforme and pancreatic cancer through upregulation of various molecules such as epithelial cell adhesion molecule and galectin-325-28. Based on these reports, it seems that the dual role of Sema3A depends mostly on the type of the cancer, and in LSCC, it may have anti-tumorigenic effects as its concentration in the sera of the participants of the present study was lower than those from normal individuals.

Literature predominantly introduces Sema3C as a mediator orchestrating angiogenesis, tumour progression and thus of poor prognosis in various types of cancers27. However, it has been reported that Sema3C promotes the activation of multiple receptor tyrosine kinase pathways in prostate cancer cells, which is a key mechanism for mediating cancer growth, survival and treatment resistance26. Similarly, it has been found that aberrant Sema3C expression is associated with poor survival in individuals with pancreatic cancer27. Sema3C knocking down attenuates the proliferation, migration, invasion and epithelial–mesenchymal transition (EMT) in pancreatic cancer cell lines28,29. Sema3C might be a new therapeutic target for preventing cervical cancer as it is associated with poor prognosis of cervical cancer and promotes tumour growth through the activation of the pERK pathway30. In line with these reports, the results of the present study showed higher expression of the Sema3C gene in tumoural tissue as compared to non-tumoural tissues. There was also an association between Sema3C and higher stages of LSCC. Consequently, the pro-tumorigenic role of Sema3C in the development of LSCC is predictable, probably through its promotive effects on cell proliferation, colony formation, angiogenesis and orchestrating EMT. On the other hand, like other members of Sema3 family, Sema3C has been reported to have contradictory roles. Furthermore, U87 glioblastoma cells overexpressing Sema3C have been shown not to encourage new vessels formation in chick chorioallantoic membranes demonstrating anti-angiogenic nature31. Similarly, Salimi-Sotoodeh et al identified Sema3C as well as Sema3A as appropriate inhibitors of pathological angiogenesis in human meningioma32. Therefore, we speculated that the effects of this semaphorin may be dependent on the environment and tumour type.

Sema4D has been reported to be a regulator of tumour progression by promoting angiogenesis33. Furthermore, an association was observed between Sema4D upregulation and poor prognosis in cervical cancer34-36. Alternatively, Sema4D is an immune semaphorin that induces the antibody production by B-lymphocytes and antigen presentation, activation and maturation in dendritic cells. This semaphorin is able to promote the production of cytokines such as interleukin-12 and tumour necrosis factor-α by monocytes34. Based on the present data reporting a decreased expression of Sema4D, and considering the immune-promoting effects of this protein, it can be concluded that downregulation of Sema4D may partly impair the activity and function of distinct immune cells such as B- and T-lymphocyte, DCs and monocytes in individuals with LSCC35.

As a limitation this study did not assess individuals with benign tumours, which is needed to be clarified in future studies. Furthermore, the expression data from the study may not be sufficient to interpret pertinent mechanisms and hence more studies are required.

Overall, based on the results of this study demonstrating an increased expression of Sema3C in LSCC tissues compared with non-tumour surrounding tissues as well as its increase in stage IV, this protein may be considered as an angiogenic or tumourogenic factor in individuals with LSCC. In contrast, since Sema4D showed decreased expression and considering its role as an immune mediator, it may cause the downregulation of the activity of immune cells in this malignancy.

Financial support and sponsorship

This study was financially supported by Shiraz University of Medical Sciences, Shiraz, Iran (Grant no. 93-01-16-8497), Shiraz Institute for Cancer Research (ICR-100-504) and Kerman University of Medical Sciences (Grant no. 940499).

Conflicts of interest

None.

References

  1. , , , , , . Expression of semaphorin class 3 is higher in the proliferative phase on the human endometrium. Arch Gynecol Obstet. 2018;297:1175-9.
    [Google Scholar]
  2. , , , . Semaphorin 3B gene suppresses tumor growth through the p53 signaling pathway and neuropilin receptors. Am J Clin Exp Med. 2017;5:234-8.
    [Google Scholar]
  3. , , , , , , . Comprehensive genomic profiling of head and neck squamous cell carcinoma reveals FGFR1 amplifications and tumour genomic alterations burden as prognostic biomarkers of survival. Eur J Cancer. 2018;91:47-55.
    [Google Scholar]
  4. , , , , , , . Prognostic value of immunoexpression of CCR4, CCR5, CCR7 and CXCR4 in squamous cell carcinoma of tongue and floor of the mouth. Med Oral Patol Oral Cir Bucal. 2019;24:e354-63.
    [Google Scholar]
  5. , , , , , . Head and neck squamous cell carcinoma detection and surveillance: Advances of liquid biomarkers. Laryngoscope. 2019;129:1836-43.
    [Google Scholar]
  6. , , . The role of angiogenesis in cancer treatment. Biomedicines. 2017;5:34.
    [Google Scholar]
  7. , . Vascular endothelial growth factor (VEGF) and its receptor (VEGFR) signaling in angiogenesis:a crucial target for anti-and pro-angiogenic therapies. Genes &cancer. 2011;2((12)):1097-105.
    [Google Scholar]
  8. , , , , , . Class-3 semaphorins and their receptors:potent multifunctional modulators of tumor progression. Int J mol Sci. 2019;20((3)):556.
    [Google Scholar]
  9. , , , . Anti-VEGF/VEGFR therapy for cancer: Reassessing the target. Cancer Res. 2012;72:1909-14.
    [Google Scholar]
  10. , , , , , , . The semaphorins and their receptors as modulators of tumor progression. Drug Resist Updat. 2016;29:1-12.
    [Google Scholar]
  11. , , , , . Semaphorins in angiogenesis and tumor progression. Cold Spring Harb Perspect Med. 2012;2:a006718.
    [Google Scholar]
  12. , , , , , . Expression of major histocompatibility complex class I polypeptide-related sequence B in adipose-derived stem cells from breast cancer patients and normal individuals. J Cancer Res Ther. 2019;15:1067-72.
    [Google Scholar]
  13. , , , , , , . The role of the semaphorins in cancer. Cell Adh Migr. 2016;10:652-74.
    [Google Scholar]
  14. , , , , , , . CD100/Plexin-B1 interactions sustain proliferation and survival of normal and leukemic CD5+B lymphocytes. Blood. 2003;101:1962-9.
    [Google Scholar]
  15. , , , , , , . Overexpression of semaphorin-3A and semaphorin-4D in the peripheral blood from newly diagnosed patients with chronic lymphocytic leukemia. Int J Hematol Oncol Stem Cell Res. 2019;13:25-34.
    [Google Scholar]
  16. , , , , , , . Semaphorin 4D, a lymphocyte semaphorin, enhances tumor cell motility through binding its receptor, plexinB1, in pancreatic cancer. Cancer Sci. 2011;102:2029-37.
    [Google Scholar]
  17. , , , , , , . Semaphorin 4D expression is associated with a poor clinical outcome in cervical cancer patients. Microvasc Res. 2014;93:1-8.
    [Google Scholar]
  18. , , , , . SEMA6D expression and patient survival in breast invasive carcinoma. Int J Breast Cancer. 2015;2015:539721.
    [Google Scholar]
  19. , , , , . Expression of semaphorin 6D in gastric carcinoma and its significance. World J Gastroenterol. 2006;12:7388-90.
    [Google Scholar]
  20. , , , , , , . Semaphorin 4A, 4C, and 4D: Function comparison in the autoimmunity, allergy, and cancer. Gene. 2020;746:144637.
    [Google Scholar]
  21. , , , , , , . A deep convolutional neural network-based method for laryngeal squamous cell carcinoma diagnosis. Ann Transl Med. 20211797;9
    [Google Scholar]
  22. , , , , . An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath. 2013;3:71-85.
    [Google Scholar]
  23. , , , , , , . Semaphorin 3A upregulates FOXO 3a-dependent MelCAM expression leading to attenuation of breast tumor growth and angiogenesis. Oncogene. 2015;34:1584-95.
    [Google Scholar]
  24. , , , , , , . Novel role of semaphoring 3A in the growth and progression of hepatocellular carcinoma. Oncol Rep. 2017;37:3313-20.
    [Google Scholar]
  25. , , , , , . Autocrine semaphorin 3A signaling promotes glioblastoma dispersal. Oncogene. 2009;28:3537-50.
    [Google Scholar]
  26. , , , , , , . Association of axon guidance factor semaphorin 3A with poor outcome in pancreatic cancer. Int J Cancer. 2007;121:2421-33.
    [Google Scholar]
  27. , . SEMA3C supports pancreatic cancer progression by regulating the autophagy process and tumor immune microenvironment. Front Oncol. 2022;12:890154.
    [Google Scholar]
  28. , , , , , , . Increased semaphorin 3c expression promotes tumor growth and metastasis in pancreatic ductal adenocarcinoma by activating the ERK1/2 signaling pathway. Cancer Lett. 2017;397:12-22.
    [Google Scholar]
  29. , , , , , , . SEMA3C drives cancer growth by transactivating multiple receptor tyrosine kinases via Plexin B1. EMBO Mol Med. 2018;10:219-38.
    [Google Scholar]
  30. , , , , . SEMA3C promotes cervical cancer growth and is associated with poor prognosis. Front Oncol. 20191035;9
    [Google Scholar]
  31. , , , . Semaphorins in angiogenesis and autoimmune diseases: Therapeutic targets? Front Immunol. 2020;11:346.
    [Google Scholar]
  32. , , , , , , . Correlation of peritumoral edema and microvessel density with tissue expression of VEGF, semaphorins 3A and 3C in patients with meningioma. Asian Pac J Cancer Biol. 2018;3:93-8.
    [Google Scholar]
  33. , , , , , , . Semaphorin 4D enhances angiogenic potential and suppresses osteo-/odontogenic differentiation of human dental pulp stem cells. J Endod. 2017;43:297-305.
    [Google Scholar]
  34. , , , , . Sema 4D/CD100-plexin B is a multifunctional counter-receptor. Cell Mol Immunol. 2013;10:978.
    [Google Scholar]
  35. , , , , , , . The role of semaphorin 4D in tumor development and angiogenesis in human breast cancer. Onco Targets Ther. 2016;9:5737-50.
    [Google Scholar]
  36. , , , . Semaphorin signaling in angiogenesis, lymphangiogenesis and cancer. Cell Res. 2012;22:23-32.
    [Google Scholar]
Show Sections
Scroll to Top