Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
View/Download PDF

Translate this page into:

Correspondence
142 (
1
); 85-87
doi:
10.4103/0971-5916.162130

High heterozygosity frequency of three exonic SNPs of factor V gene (F5): implications for genetic diagnosis

National Institute of Immunohaematology (ICMR), 13th Floor, KEM Hospital, Parel, Mumbai 400 012, Maharashtra, India

* For correspondence: shrimatishetty@yahoo.com

Licence

This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Disclaimer:
This article was originally published by Medknow Publications & Media Pvt Ltd and was migrated to Scientific Scholar after the change of Publisher.

Sir,

Isolated coagulation factor V (FV) deficiency (parahaemphilia) is a rare autosomal recessive bleeding disorder affecting both sexes with a prevalence of about one in one million1. Patients with FV deficiency exhibit mild to severe bleeding symptoms with clinical manifestations ranging from ecchymosis, menorrhagia, epistaxis to haemarthrosis and intracranial bleeds12. The factor V (F5) gene is located on chromosome 1q23, spans about 80 kb and has 25 exons and 24 introns with a 7 kb mRNA which encodes a protein of 2224 amino acids. The complete F5 cDNA sequence has already been published34. More than 100 mutations and 700 polymorphisms have been reported in the F5 mutation database5.

Among all coagulation disorders, FV deficiency is the least characterized disorder at the molecular level. Patients with FV deficiency generally exhibit a bleeding tendency of variable severity; intracranial and gastrointestinal haemorrhages, haematomas and haemarthroses are also reported in a few patients. Major phenotypic determinant in FV deficiency has been reported to be platelet FV levels6. Though the disease is rare in countries like India where consanguineous marriages are common, there is a high prevalence of autosomal recessive disorders including FV deficiency. Except one report7, there is no published study on the molecular characterization of FV deficient cases from India. Direct sequencing of the gene though accurate, is not cost-effective due to the large size of the gene and heterogeneity of mutations and is thus difficult to implement in many laboratories. Indirect method of gene tracking is an extremely simple and accurate method, when it is based on intragenic markers. However, assessing the informativeness of the marker in each population is important as there is a considerable variation in the heterozygotic frequency of these markers in different populations8910. In the present study, polymorphisms in F5 were analysed in a group of healthy individuals with an objective to utilize them for genetic diagnosis in FV deficient families by direct DNA sequencing.

The study was conducted at the Department of Haemostasis and Thrombosis, National Institute of Immunohaematology, Mumbai, India, including 65 unrelated healthy subjects from the Institute. After obtaining informed written consent, 10 ml blood sample was collected from each participant in EDTA and DNA was extracted from these samples using commercial kits (Invitrogen, CA, USA). PCR amplification was performed using primers designed by primers 3 and UCSC genome browser (Sigma Aldrich, India). The PCR reaction mixture consisted of 1U Taq polymerase (Bioron, Ludwigshafen, Germany), 1.5 mmol/l magnesium chloride, 1 μmol/l of the forward and reverse primers and 150 ng of DNA. The primer sequences and PCR conditions for exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) polymorphisms were as follows:

Exon 13 (637 bp) - forward (5’-3’) TGCTGACTATGATTACCAGA, reverse (5’-3’) GAGTAACAGATCACTAGGAGG.

PCR conditions: Denaturation at 94°C for 5 min followed by 35 cycles of denaturation (95°C, 40 sec), annealing (56°C, 40 sec), and extension (72°C for 40 sec) along with a final extension at 72°C for five minutes.

Exon 16 (286 bp) - forward (5’-3’) GAGGCAATACAATTTACTC, reverse (5’-3’) CAGTGTGATTTAATTAGGAG.

PCR conditions: Denaturation at 94°C for 5 min followed by 30 cycles of denaturation (95°C, 1 min), annealing (55°C, 2 min), extension (72°C for 1 min), followed by a final extension at 72°C for seven minutes.

Amplified products were subjected to direct sequencing of the exons and the intron - exon boundaries of F5 using an ABI 3130 genetic analyzer (Applied Biosystems, USA). The study protocol was approved by the Institutional Ethics Committee.

A total of 12 polymorphisms were detected, of which three showed high heterozygosity frequency in our population i.e. exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) (Table). The cumulative heterozygosity frequency of these three markers was 67.69 per cent.

Table Heterozygosity frequencies of polymorphic markers of F5

During the course of the study, a family was referred from Uttar Pradesh for antenatal diagnosis in the first trimester of pregnancy. After obtaining a detailed medical and family history, blood samples of both parents and index case were collected and the chorionic villus sampling (CVS) was done at 11th weeks of pregnancy in the mother. DNA from blood samples and CVS was isolated using commercial kits (Invitrogen, USA) and subjected to gene tracking analysis by direct DNA sequencing technique using the above three markers i.e. exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) polymorphisms. The diagnosis could be successfully offered to this family using exon 13 A2663G (K830R) polymorphism. The family was non-informative for exon 13 A2684G (H837R) and exon 16 A5380G (M1736V) markers. As the mother was homozygous for this marker, the foetus is either normal or a carrier of the mutation. Thus the diagnosis of an ‘unaffected’ foetus was offered. The child was subsequently followed up after delivery and was found to be normal for factor V levels with a normal genotype.

The present study shows that these three markers can successfully be used in carrier diagnosis and prenatal diagnosis in majority of the FV deficient families in India. Due to the high cost involved in direct DNA or mRNA analysis involved in mutation detection, indirect linkage analysis using such highly informative polymorphic markers may be considered as the method of choice for genetic diagnosis in developing countries.

References

  1. , , , . Rare inherited coagulation disorders in India. Haematologia (Budap). 1996;28:13-9.
    [Google Scholar]
  2. , , , . Recessively inherited coagulation disorders. Blood. 2004;104:1243-52.
    [Google Scholar]
  3. , , , , , , . Complete cDNA and derived amino acid sequence of human factor V. Proc Natl Acad Sci USA. 1987;84:4846-50.
    [Google Scholar]
  4. , , , . Structure of the gene for human coagulation factor V. Biochemistry. 1992;31:3777-85.
    [Google Scholar]
  5. , . An online database of mutations and polymorphisms in and around the coagulation factor V gene. J Thromb Haemost. 2007;5:185-8.
    [Google Scholar]
  6. , , , . Trends of consanguineous marriages in a Sunni Muslim population of West Bengal, India. Anthropol Anz. 2007;65:253-62.
    [Google Scholar]
  7. , , , , , , . Molecular basis of hereditary factor V deficiency in India: identification of four novel mutations and their genotype-phenotype correlation. Thromb Haemost. 2011;105:1120-3.
    [Google Scholar]
  8. , , , , , , . Coagulation factor V gene analysis in five Indian patients: identification of three novel small deletions. Haematologica. 2006;91:1724-6.
    [Google Scholar]
  9. , , , , , , . A comparison of the allelic frequencies of ten DNA polymorphisms associated with factor VIII and factor IX genes in Thai and Western European populations. Blood Coagul Fibrinol. 1994;5:29-35.
    [Google Scholar]
  10. , , , , , , . Factor VIII and IX gene polymorphisms and carrier analysis in Indian population. Am J Hematol. 1997;54:271-5.
    [Google Scholar]

    Fulltext Views
    712

    PDF downloads
    434
    View/Download PDF
    Download Citations
    BibTeX
    RIS
    Show Sections
    Scroll to Top