Translate this page into:
High expression of ZEB1 is associated with EMAST & metastasis in colorectal cancer patients
For correspondence: Dr Ehsan Nazemalhosseini-Mojarad, Gastroenterology & Liver Diseases Research Center, Research Institute for Gastroenterology & Liver Diseases, Shahid Beheshti University of Medical Sciences, P.O. Box: 19857-17411, Yeman Street, Chamran Expressway, Tehran, Iran e-mail: ehsanmojarad@gmail.com
-
Received: ,
This article was originally published by Wolters Kluwer - Medknow and was migrated to Scientific Scholar after the change of Publisher.
Abstract
Background & objectives:
Transforming growth factor-beta (TGF-β) signalling pathway has been reported to be involved in metastasis and at the same time has been considered compellingly an important mediator of epithelial-to-mesenchymal transition (EMT). Besides, EMT process is maintained by zinc-finger E-box-binding homeobox 1 (ZEB1) gene which is induced by TGF-β pathway. TGF-β has been shown to be associated with elevated microsatellite alterations at selected tetranucleotide repeats (EMAST) phenomenon, which is one of the prognostic biomarkers of colorectal cancer (CRC). This study was conducted to determine the link among ZEB1-induced TGF-β, EMAST status and metastasis.
Methods:
The expression level of ZEB1 was evaluated using quantitative reverse transcription (qRT) real-time PCR in 122 formalin fixed paraffin-embedded tissues of CRC sample with known EMAST status and TGF-β/Smad-dependent pathways. The association among ZEB1 expression, TGF-β signalling pathway, EMAST status and metastatic behaviour was examined.
Results:
ZEB1 gene expression level was higher in tumour tissues as compared to normal samples (P<0.045). In addition, ZEB1 positive expression level was associated significantly with metastasis (P=0.05), EMAST+ status (P=0.052) and activated TGF-β signalling pathway (P=0.002).
Interpretation & conclusions:
Our results validated significant association between activated TGF-β signalling pathway and EMAST+ phenotype with higher expression of ZEB1 and higher level of metastasis.
Keywords
Colorectal cancer
EMAST repeats
metastasis
TGF-β signalling pathway
ZEB1
A raft of molecular pathways appeared to be involved in tumour invasion convoluted process which results inevitably in the dissemination of carcinoma cells from their primary site1. Multiple studies have revealed that a key initial step in tumour metastasis is a molecular programme called epithelial-to-mesenchymal transition (EMT) which has been reported to be a chief event in cancer malignancy including colorectal cancer (CRC)2-4 whereby, as mentioned in studies, a clinically heterogeneous disease5-7. This well-defined system provides a mechanism for epithelial cells to acquire a mesenchymal phenotype by cell-cell junction’s dissolution and cell motility required for invasion. Consequently, cells with stem cell qualities are highly relevant issues to CRC metastasis, which leads to CRC patient’s death8. A number of research studies have revealed that EMT process is regulated by plenty of cell signalling pathways. An illustration of this is the transforming growth factor-β (TGF-β) signalling, which is considered a compelling mediator of EMT and is also an acute factor involved in tumour progression9,10. TGF-β is a dual-functional cytokine that participates either in tumour suppression by abrogating proliferation or in cancer propagation through a complicated network of canonical and non-canonical pathways in various cancer types, especially in CRC10-12. This catastrophic switching from a tumour inhibitor to promoter relies upon the cell type or tissue context13. Canonical TGF-β signalling pathway is accompanied by the activation of SMAD proteins through phosphorylation14. Afterwards, this complex translocates into the nucleus, wherein it regulates the expression of target genes such as SNAIL, TWIST and zinc-finger E-box-binding homeobox 1 (ZEB1)15, which are known deliberately as EMT programming inducers in order to maintain migration, proliferation and invasion capacity and eventually adopt a mesenchymal characteristic16. Amongst these EMT-related transcription proteins, ZEB1 is fundamentally responsible for EMT and is at the crossroad of several stages of CRC involving EMT which is a critical player in transcriptional downregulation of epithelial markers such as E-cadherin as an adherent junction and activation of mesenchymal genes17. Besides, ZEB1 gene, which is induced by TGF-β, cooperates closely with SMAD proteins throughout TGF-β signalling commencement in order to maintain EMT process18. On the other hand, the potential of many elements as prognostic biomarkers for CRC patients has been evaluated in recent studies including microsatellite instability (MSI)19 and elevated microsatellite alterations at selected tetranucleotide repeats (EMAST)20. A failure at the mismatch repair system leads to MSI and EMAST, which leads to problems like tumour progression due to the propensity for metastatic behaviour21,22. Interestingly, previous studies have examined TGF-β signalling pathway mediated by SMAD proteins as one of the overriding causes of EMAST marker, which could be responsible for poor clinical outcome in CRC cases along with EMAST-positive (EMAST+) phenotype23. Nonetheless, there is no reported link between ZEB1 transcriptional factor and EMAST biomarker, and consequently, this relation has remained enigma. The goal of this study was to elucidate the precise correlation among EMAST phenotype, ZEB1 induced by TGF-β signalling pathway and metastasis.
Material & Methods
This study was conducted in 2017 at the Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran, after obtaining approval from the Medical Ethics Committee of the Institute. One hundred and twenty two CRC patients who underwent surgery at Taleghani Hospital and Shohada Tajrish Hospital, Shahid Beheshti University of Medical Sciences, from September 2010 to March 2017 were included. In these patients, EMAST status and TGF-β/Smad-dependent pathway were determined in our previous studies23,24. The expression of ZEB1 was examined in formalin-fixed paraffin-embedded (FFPE) tumour, and normal adjacent tissues (NATs) and its association with CRC patient’s survival, EMAST marker and TGF-β/Smad-dependent pathways were investigated.
RNA isolation and gene expression profiling: Whole RNA extraction was carried out using RNeasy® FFPE kit (QIAGEN GmbH, Germany), by following the manufacturer’s instruction. RNA yield and purity were measured spectrophotometrically using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, USA). The reverse transcription reaction was carried out using PrimeScript RT Master Mix (Takara Bio Inc., Otsu, Japan) as well as Random Hexamer Primers in accordance with the procedure referred. cDNA samples were stored at −20°C till further use. ZEB1 gene expression level was detected through quantitative reverse transcription (qRT)-PCR using the LightCycler ABI 7500 Real-Time PCR System and Maxima® SYBR Green/Rox with MicroAMP optical 96-well reaction (Applied Biosystems, USA); qRT-PCR was carried out as per the following conditions: five seconds of pre-denaturation at 95°C accompanied by 45 cycles containing denaturation at 95°C for five seconds, annealing for 34 sec at 60°C and a final extension at 72°C for 30 sec. Accurate measurements of each sample were made in duplicate. A final volume of 20 μl including 0.4 μl of each primer, 10 μl Maxima SYBR Green/Rox and 4 μl cDNA was used for real-time PCR analysis. The 2−∆∆CT (threshold cycle) approach was applied for gene expression quantification, by which, Ct values were normalized to the housekeeping gene, β-actin and relative gene expression values were determined. Forward and reverse primers used were as follows: ZEB1 (forward primer: GAATTCACAGTGGAGAGAAGCC, reverse primer: GGAGCCAGAATGGGAAAAGCG) and β-actin (forward primer: CACCATTGGCAATGAGCGGTTC, reverse primer: AGGTCTTTGCGGATGTCCACGT). LinReg Software (Linreg version 2017.1, Amsterdam, the Netherlands) was applied in order to assess the productiveness of the afore-mentioned primers. The relative quantitation (RQ) values were included in statistical analysis.
Statistical analyses: The data was analyzed using the SPSS statistical software version 16.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 6.01 (GraphPad Software Inc., San Diego, USA). The Chi-squared method was applied to assess the disparities among variables. The information consistent with normal distribution was stated as mean ± standard deviation and examined with paired t test. Likewise, Student’s t test was applied with the aim of comparing gene expression levels between two separate variables. Kaplan-Meier curves for overall survival were made using GraphPad Prism software. In addition, a log-rank test was used to approach the contrast through survival curve groups.
Results
Forty nine (40%) of the 122 patients with CRC had a tumour with EMAST+ phenotype and the rest of them (59.8%, n=73) had a tumour with EMAST- phenotype. The expression level of ZEB1 gene was of significantly higher in tumour tissues as compared to NATs (P<0.045, Fig. 1). Among 122 patients, the mean value of RQ for ZEB1 was 2.70±2.56 in CRC tumours (median, 2.22).

Overexpression of ZEB1 was observed in tumour specimens in 68 per cent (83/122) of all analyzed patients. The difference in the mean values of RQ for each marker is outlined in Table in accordance with the clinicopathological features and EMAST phenotype. As depicted, the mean values of RQ for ZEB1 were not significant in terms of stage and differentiation. Patients characterized with metastasis compared to non-metastatic indicated a significant higher mean value of RQ for ZEB1 (P=0.05). Moreover, ZEB1 overexpression was significantly higher in tumours associated with activated TGF-β signalling pathway (P=0.002). Similarly, the mean values of RQ for ZEB1 found to be higher in tumours marked with EMAST+ status (P=0.052). Thirty nine patients (32%) died during 50 months of follow up (range, 8-82 months). The mean overall survival (OS) time for all the patients was 50 months, with nominal 1-, 3- and 5-yr survival of 96, 88 and 49 per cent, respectively. Information thus gleaned indicated that increased expression of ZEB1, which is shown in Figure 2, was not linked significantly with reduced OS (P=0.140), in comparison to patients with low ZEB1 expression. The TGF-β/Smad-dependent pathway was active in 27.9 per cent (n=34) of patients, and inactive in 72.1 per cent (n=88) of the patients.
| Characteristics | Total, n (%) | ZEB1 expression Mean±SD |
|---|---|---|
| Tumour stage | ||
| I-II | 70 (85.4) | 2.33±2.31 |
| III-IV | 52 (14.6) | 3±2.81 |
| Differentiation | ||
| Well | 40 (48.8) | 3.23±3.14 |
| Moderate/poor | 82 (51.2) | 2.32±2.15 |
| Metastasis | ||
| Yes | 52 (14.6) | 2.96±2.47* |
| No | 70 (85.4) | 2.36±2.59 |
| EMAST | ||
| Negative | 73 (89.06) | 2.4±2.65 |
| Positive | 49 (10.94) | 2.94±2.37ϯ |
| TGF-β signalling | ||
| Negative | 88 (72.13) | 2.27±2.48 |
| Positive | 34 (27.86) | 3.5±2.54δ |
*P<0.05 compared to no metastasis; ϯP<0.05 compared to EMAST-; δP <0.01 compared to TGF-β signalling negative. ZEB1, zinc-finger E-box-binding homeobox 1; SD, standard deviation; EMAST, elevated microsatellite alterations at selected tetranucleotide repeats; TGF-β, transforming growth factor-β

Discussion
A shred of genetic evidence which is characterized as a distinct model of MSI is called EMAST and has been observed in 60 per cent of CRC patients25. It is claimed that a large number of CRCs harbour EMAST+ status, which means CRC tumours are strongly associated with EMAST+ phenomenon26. It has now been proposed that there is a significant correlation between EMAST+ status and metastatic cascade; nonetheless, the mechanism operating behind this association has not been ascertained yet. The most striking result emerging from the present study was higher gene expression of ZEB1 in tumour specimens compared with normal samples. Besides, ZEB1 gene expression was at a higher level in patients with metastasis as compared to non-metastatic patients. With this in mind, our results drew attention towards that patients characterized with activated TGF-β signalling pathway and EMAST+ phenotype indicating higher expression of ZEB1 and a significantly higher rate of metastases. It is notable that the prevalence of EMAST status and its link with clinical features as well as CRC progression is not widely known; nonetheless, both the prevalence and the predictive role and impact of EMAST are highly controversial due to the limited number and inconsistencies of studies. Moreover, the present study concentrated on the role of TGF-β signalling cascade in CRC. TGF-β/Smad signalling pathway has both crucial and heterogeneous roles in CRC. Moreover, the stated signalling pathway is an indispensable element in EMT programming. TGF-β ligand leads to enhancement of TRI and TRII receptor’s dimerization which engenders Smad protein phosphorylation. Eventually, Smad2 and Smad3 are activated and relocated to the nucleus, bounding to Smad4 protein so as to act as a transcriptional regulatory factor27. Importantly, advanced CRC tumours showed an activated TGF-β signalling pathway. Lou et al28 revealed that overexpression of TGF-β 1 was higher in tumours with higher stages (III and IV) rather than lower stages (I and II). Furthermore, a multistep complicated discrete process in which tumour cells travel from an initial tumour site to a different organ is called tumour metastasis and this feature makes it the principal cause of failed chemotherapy29. On the basis of published studies30-32, numerous mechanisms underlying tumour metastasis have been elucidated, namely EMT, which is a decisive step in cancer metastasis and is strongly regulated by several signalling pathways including TGF-β/Smad pathway. The best transcriptional activators of EMT are Snail1, Twist, Zeb1 and Slug which are instrumental in tumour progression11. Furthermore, in a previous analysis33, a significant correlation between EMT-activator Snail1 gene expression and EMAST+ phenotype was highlighted. Once the TGF-β signalling pathway is activated, ZEB1 transcription factor’s expression increases which, in turn, regulates EMT-related gene expression18,29. Watson et al34 reached a conclusion that EMAST+ phenotype is associated with advanced stages in CRC. Furthermore, the stated association was confirmed by Devaraj et al20 in another study. There is a shred of emerging evidence that this biomarker, EMAST, is a metastasis modulator, which can generate genetic pathways that transform normal cells into cancer cells and potentially cause metastasis through inflammation rather than oncogenic transformations35. Nevertheless, Garcia et al36 suggested that HIF-1-induced hypoxia links EMAST+ biomarker to recurrent metastasis. On the other hand, Gonzalez et al37 unveiled that in CRC cells, TGF-β induces EMT, invasion and endothelial migration through SMAD2, SMAD3 and SMAD1/5/8 activation. Consistent with other studies23,38, an activated TGF-β/Smad canonical signalling pathway had a strong correlation with the existence of EMAST+ phenotype. Zhang et al39 outlined that the expression rate of ZEB1 in colorectal tissue cells was at a higher level than NATs and accordingly, higher ZEB1 expression was significantly associated with hepatic metastasis. It has now been demonstrated that the positive expression level of ZEB1 has been associated with differentiation, meaning that higher expression of ZEB1 had a greater frequency in poorly differentiated CRC tumours than in highly or moderately differentiated CRC tumour tissues40. There is some evidence to strongly suggest that TGF-β signalling pathway causes ZEB1 transcriptional factors to increase through Smad4-dependent pathways leading to EMT response41. The present research was undertaken in order to Figure out the significant association between ZEB1 expression and metastasis with TGF-β signalling pathway activation and appearance of EMAST phenomenon. A consensus molecular subtype (CMS) classification system is the most reliable system for classifying CRC, which maintains a link between distinct molecular characteristics and biological subcategories. The CMS signature is divided into four subclasses from CMS1 to CMS4 and each subtype has a biological and molecular framework42. Previous studies have defined a panel for CMS4 subtype in which CMS4 is hallmarked by EMT-related gene expression and TGF-β signalling pathway activation43. Based on the combined data analysis of the present study, which suggested a significant association between TGF-β activation and EMAST status with ZEB1 expression, it is hypothesized that EMAST biomarker can also be a feature characteristic of CMS4.
Moderate sample size (122 samples) is one of the main limitation of the present study, and therefore, this should be further investigated using a greater sample size in future studies. Additional studies are therefore required to further investigate the associations between TGF-β activation and EMAST status with ZEB1 expression.
Financial support & sponsorship: The study was funded by the Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran (Grant No. 946).
Conflicts of Interest: None.
References
- Molecular mechanisms of colon cancer progression and metastasis:recent insights and advancements. Int J Mol Sci. 2020;22:130.
- [Google Scholar]
- The upstream components of the Wnt signalling pathway in the dynamic EMT and MET associated with colorectal cancer progression. Clin Exp Metastasis. 2008;25:657-63.
- [Google Scholar]
- Regulation of EMT in colorectal cancer:a culprit in metastasis. Cancers (Basel). 2017;9:171.
- [Google Scholar]
- The molecular mechanisms and therapeutic strategies of EMT in tumor progression and metastasis. J Hemat Oncol. 2022;15:1-27.
- [Google Scholar]
- Heterogeneity in colorectal cancer:a challenge for personalized medicine? Int J Mol Sci. 2018;19:3733.
- [Google Scholar]
- Exploring and modelling colon cancer inter-tumour heterogeneity:opportunities and challenges. Oncogenesis. 2020;9:1-5.
- [Google Scholar]
- The integrated pathway of TGFβ/Snail with TNFα/NFκB may facilitate the tumor-stroma interaction in the EMT process and colorectal cancer prognosis. Sci Rep. 2017;7:4915.
- [Google Scholar]
- Fucosylated TGF-βreceptors transduces a signal for epithelial-mesenchymal transition in colorectal cancer cells. Br J Cancer. 2014;110:156-63.
- [Google Scholar]
- IGFBP-rP1 suppresses epithelial-mesenchymal transition and metastasis in colorectal cancer. Cell Death Dis. 2015;6:e1695.
- [Google Scholar]
- TGF-β:duality of function between tumor prevention and carcinogenesis. J Natl Cancer Inst. 2014;106:djt369.
- [Google Scholar]
- FRA-1 as a driver of tumour heterogeneity:A nexus between oncogenes and embryonic signalling pathways in cancer. Oncogene. 2015;34:4421-8.
- [Google Scholar]
- Role of TGF-βin metastatic colon cancer:It is finally time for targeted therapy. Cell Tissue Res. 2017;370:29-39.
- [Google Scholar]
- Ursolic acid suppresses the invasive potential of colorectal cancer cells by regulating the TGF-β1/ZEB1/miR-200c signaling pathway. Oncol Lett. 2019;18:3274-82.
- [Google Scholar]
- MicroRNAs as therapeutic targets and colorectal cancer therapeutics. In:Non-coding RNAs in colorectal cancer. Adv Exp Med Biol. 2016;937:239-47.
- [Google Scholar]
- A transient, EMT-linked loss of basement membranes indicates metastasis and poor survival in colorectal cancer. Gastroenterology. 2006;131:830-40.
- [Google Scholar]
- Functional cooperation between Snail1 and twist in the regulation of ZEB1 expression during epithelial to mesenchymal transition. J Biol Chem. 2011;286:12024-32.
- [Google Scholar]
- Prognostic value of ZEB-1 in solid tumors:A meta-analysis. BMC Cancer. 2019;19:635.
- [Google Scholar]
- A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition:Development of international criteria for the determination of microsatellite instability in colorectal cancer. Cancer Res. 1998;58:5248-57.
- [Google Scholar]
- Relationship of EMAST and microsatellite instability among patients with rectal cancer. J Gastrointest Surg. 2010;14:1521-8.
- [Google Scholar]
- The effect of DNA mismatch repair (MMR) status on oxaliplatin-based first-line chemotherapy as in recurrent or metastatic colon cancer. Med Oncol. 2010;27:1277-85.
- [Google Scholar]
- Multicenter retrospective analysis of metastatic colorectal cancer (CRC) with high-level microsatellite instability (MSI-H) Ann Oncol. 2014;25:1032-8.
- [Google Scholar]
- TGF-β/SMAD signaling pathway as a candidate for EMAST phenotype in colorectal cancer patients. World Cancer Res J. 2020;7:e1470.
- [Google Scholar]
- MSI-L/EMAST is a predictive biomarker for metastasis in colorectal cancer patients. J Cell Physiol. 2019;234:13128-36.
- [Google Scholar]
- Efficacy of adjuvant 5-fluorouracil therapy for patients with EMAST-positive stage II/III colorectal cancer. PLoS One. 2015;10:e0127591.
- [Google Scholar]
- Elevated microsatellite alterations at selected tetra-nucleotide repeats (EMAST) testing in colorectal cancer using the cost-effective Qiaxcel advanced platform. World Cancer Res J. 2019;6:e1263.
- [Google Scholar]
- Inactivation of the type II TGF-beta receptor in colon cancer cells with microsatellite instability. Science. 1995;268:1336-8.
- [Google Scholar]
- SOX2 targets fibronectin 1 to promote cell migration and invasion in ovarian cancer:New molecular leads for therapeutic intervention. OMICS. 2013;17:510-8.
- [Google Scholar]
- Pien Tze Huang inhibits metastasis of human colorectal carcinoma cells via modulation of TGF-β1/ZEB/miR-200 signaling network. Int J Oncol. 2015;46:685-90.
- [Google Scholar]
- TGF-β-mediated epithelial-mesenchymal transition and cancer metastasis. Intl J Mol Sci. 2019;20:2767.
- [Google Scholar]
- Role of the transforming growth factor-βsignaling pathway in the pathogenesis of colorectal cancer. J Cell Biochem. 2019;120:8899-907.
- [Google Scholar]
- Transforming growth factor-βsignaling in epithelial-mesenchymal transition and progression of cancer. Proc Japan Acad Ser B Phys Biol Sci. 2009;85:314-23.
- [Google Scholar]
- High expression of Snail1 is associated with EMAST and poor prognosis in CRC patients. Gastroenterol Hepatol Bed Bench. 2019;12((Suppl 1)):S30-6.
- [Google Scholar]
- Elevated microsatellite alterations at selected tetranucleotides in early-stage colorectal cancers with and without high-frequency microsatellite instability:Same, same but different? Cancer Med. 2016;5:1580-7.
- [Google Scholar]
- EMAST is a form of microsatellite instability that is initiated by inflammation and modulates colorectal cancer progression. Genes (Basel). 2015;6:185-205.
- [Google Scholar]
- Association between recurrent metastasis from stage II and III primary colorectal tumors and moderate microsatellite instability. Gastroenterology. 2012;143:48-50.e1.
- [Google Scholar]
- Co-migration of colon cancer cells and CAFs induced by TGFβ1 enhances liver metastasis. Cell Tissue Res. 2015;359:829-39.
- [Google Scholar]
- 42 downregulation of TGF-ßsignaling pathway invokes genomic instability in liver cancers. Gastroenterology. 2012;142:S-11-2.
- [Google Scholar]
- High expression of ZEB1 correlates with liver metastasis and poor prognosis in colorectal cancer. Oncol Lett. 2013;5:564-8.
- [Google Scholar]
- Roles of STAT3 and ZEB1 proteins in E-cadherin down-regulation and human colorectal cancer epithelial-mesenchymal transition. J Biol Chem. 2012;287:5819-32.
- [Google Scholar]
- A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Cancer Res. 2008;68:7846-54.
- [Google Scholar]
- Consensus molecular subtype classification of colorectal adenomas. J Pathol. 2018;246:266-76.
- [Google Scholar]
- Back to the colorectal cancer consensus molecular subtype future. Curr Gastroenterol Rep. 2019;21:5.
- [Google Scholar]
