Translate this page into:
Expression of circulating p38 inhibited cutaneous squamous cell carcinoma-associated long non-coding RNA in rheumatoid arthritis: A descriptive study
For correspondence: Prof. Anjali Aggarwal, Department of Anatomy, Post Graduate Institute of Medical Education and Research, Chandigarh 160 012, India e-mail: anjli_doc@yahoo.com
-
Received: ,
Accepted: ,
Abstract
Background & objectives
Rheumatoid arthritis (RA) is a chronic inflammatory disease characterised by joint destruction. Long non-coding RNAs (lncRNAs) have emerged as key regulators in RA pathogenesis. This study explores the serum expression of p38-inhibited cutaneous squamous cell carcinoma-associated lncRNA (PICSAR lncRNA) as a potential non-invasive biomarker for RA.
Methods
PICSAR lncRNA expression was measured in serum samples from 36 individuals with RA and 20 healthy individuals using qRT-PCR over a 24 h time course. Correlation analyses with demographic and biochemical parameters, American College of Rheumatology (ACR) scores, and ROC analysis were conducted to evaluate the diagnostic potential of PICSAR lncRNA.
Results
We observed significant upregulation of PICSAR lncRNA in individuals with RA at 0 h (448.9±358.6, P=0.0059) and 6 h (202.0±121.2, P=0.0005) compared to healthy individuals, with stable levels maintained up to 24 h. The ROC analysis yielded a substantial AUC value of 0.74 for PICSAR lncRNA in individuals with RA. In females with RA, PICSAR lncRNA levels showed a positive correlation with ACR scores and a negative correlation with age.
Interpretation & conclusions
PICSAR lncRNA is implicated in RA pathogenesis and may serve as a potential non-invasive diagnostic biomarker for RA.
Keywords
Diagnosis
non-invasive biomarker
PICSAR long non-coding RNA
rheumatoid arthritis
Rheumatoid arthritis (RA) is a chronic autoimmune disorder marked by synovial inflammation, leading to joint damage, disability, and reduced quality of life1. Current diagnostic tools based on biochemical analysis for rheumatoid factor (RF), anti-cyclic citrullinated peptide (anti-CCP) levels, C-reactive Protein (CRP), and erythrocyte sedimentation rate (ESR) lack specificity, emphasising the need for robust and specific biomarkers for early RA diagnosis2. The pathogenesis of this disease involves the dynamic interplay among various cell types, such as T cells, B cells, macrophages, and fibroblast-like synoviocytes (FLSs), in conjunction with pro-inflammatory cytokines3-5. The challenge in addressing RA lies in the incomplete understanding of its pathogenesis.
In the context of RA, gene expression is altered in immune cells and synovial tissues, partly due to long non-coding RNAs (lncRNAs), which modulate coding genes via miRNAs and recruit chromatin-modifying proteins6. These have been recognised as key regulators of gene expression, involved in inflammatory pathways, epigenetic modifications, and cell differentiation, making them promising candidates for diagnostic and therapeutic biomarkers7,8. Previous studies have identified several lncRNA-mRNA interactions in PBMCs of individuals with RA, suggesting that lncRNAs contribute to RA pathogenesis by regulating matrix metalloproteinases, NF-κB signalling, and T-cell-mediated immune responses8,9. One notable lncRNA, p38-inhibited cutaneous squamous cell carcinoma-associated lncRNA (PICSAR), has been implicated in the initiation and progression of various human cancers10,11. Recent studies have shown that PICSAR lncRNA is highly expressed in RA-FLS and synovial fluid, where it promotes inflammation by sponging miR-4701-5p. Silencing PICSAR lncRNA reduces IL-6, IL-8, and MMP-3 levels, which suggests its involvement in synovial invasion and joint damage in RA12.
Serum or plasma lncRNA assays offer potential not only for RA diagnosis but also for prognosis and treatment response prediction. PICSAR lncRNA, though elevated in inflammatory conditions, has not been explored as a non-invasive biomarker in RA. This study investigated the serum expression of PICSAR lncRNA among individuals with RA from India and its correlation with disease severity.
Materials & Methods
Study participants
A total of 36 clinically diagnosed individuals with RA (9 males and 27 females), with a mean age of 48.06±2.225 yr (range: 24.0-73.0 yr), were recruited from the department of Orthopaedics at the Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India between December 2021 and December 2023. Additionally, 20 healthy volunteers (mean age 42±2 yr, range: 27-66 yr) with no significant medical history were recruited as controls for this study. Individuals were recruited based on the American College of Rheumatology (ACR) diagnostic criteria for RA, which use a scoring system covering joint involvement (number of small and large joints), serology (RF, anti-CCP), acute-phase reactants (CRP, ESR), and symptom duration (≥6 wk)13. A total score of ≥6/10 was required for inclusion. Individuals with RA-mimicking conditions (e.g., osteoarthritis, crystal arthropathy, septic or tubercular arthritis) were excluded to ensure a well-defined RA cohort and enhance study reliability. The ACR score of male individuals with RA (mean age 56.55±4.74 yr, range: 26-72 yr) was 7.11±0.35, while that of female individuals (mean age 45.22±2.2 yr, range: 24-63 yr) was 7.11±0.21. The study was approved by the Institutional Ethics Committee, and informed consent was obtained from all participants.
Sample processing
Approximately 5 ml of venous blood was collected, and serum was separated by centrifugation. To assess PICSAR lncRNA stability, serum samples were kept at room temperature for 0-24 h before storage at -80°C for subsequent RNA isolation.
Total RNA extraction and PICSAR lncRNA expression analysis by real-time PCR
Total RNA was extracted from 200 µl of serum using the standard TRIzol™ Reagent method. cDNAs were synthesised from 250 ng RNA using the High-Capacity cDNA Reverse Transcriptase kit (Applied Biosystems; Thermofisher Scientific, Inc., USA) as per manufacturer protocol. The primers for PICSAR lncRNA and housekeeping gene (GAPDH and 18S rRNA) were designed using Primer3 software. The sequence of primers used in this study for lncRNA PICSAR are forward primer: 5’ GGTGCCTCTTCCTCAGACATCT3’, reverse primer: 5’ CAAGGAAAAGGACTGGGCTGG 3’ and for 18S rRNA are forward primer: 5’-GTAACCCGTTGAACCCCATT-3’, reverse primer: 5’-CCATCCAATCGGTAGTAGCG-3’. The expression of lncRNA was quantified by real-time qPCR using DyNAmoColorFlash SYBR Green qRT-PCR kit (Applied Biosystems; Thermofisher Scientific, Inc., USA) as per the manufacturer’s instructions. Relative expression of the target PICSAR gene was determined in all the RA samples after normalisation with the control and the housekeeping gene using the 2−ΔΔCt method14.
Correlation of PICSAR lncRNA expression with demographic features, biochemical parameters, and severity of RA
To further investigate the association of PICSAR lncRNA with demographic and biochemical parameters, as well as the severity of RA, correlations were assessed with age, gender, RF, anti-CCP, CRP, ESR, and ACR scores.
Statistical analysis
All statistical analyses were performed using GraphPad Prism version 6.0 (GraphPad Software, San Diego, CA). Data normality was assessed using the D’Agostino-Pearson omnibus test. For normally distributed data with equal variances, the unpaired Student’s t-test was used for two-group comparisons, while one-way ANOVA was applied for multiple groups. For non-normally distributed data, the Kruskal-Wallis test was used. Results are expressed as Mean±SEM from at least three independent experiments. Correlations between PICSAR lncRNA expression and clinical parameters were evaluated using Spearman’s rank correlation test. ROC curves and AUC were used to assess the diagnostic potential of PICSAR lncRNA. A P ≤ 0.05 was considered statistically significant.
Results
Increased levels of classical rheumatoid markers in RA
The levels of classical biochemical markers such as RF (190.9±73.88 IU/ml), anti-CCP (46.27±12.18 IU/ml), CRP (14.70±4.32 mg/l), and ESR (41.31±4.04 mm/h) were found to be markedly elevated from normal reference levels in all the participants with RA (Supplementary Table I). The demographic details of individuals with RA has been shown in supplementary figure 1.
Increased relative expression of PICSAR lncRNA in RA
PICSAR lncRNA expression was elevated in participants with RA compared to controls at all time points- 0, 6, 12, and 24 h (Supplementary Table II). A significant increase was observed at 0 h (448.9 ± 358.6, P = 0.0059) and 6 h (202.0 ± 121.2, P = 0.0005) (Fig. 1A-C). Although levels remained elevated at 12 and 24 h, the differences were not statistically significant. Overall, only a minimal decline in expression was noted across time points, supporting its potential as a stable biomarker. PICSAR lncRNA was also markedly elevated in both male and female individuals with RA compared to controls (Supplementary Table II). In females, expression was significantly higher at 0 h (581.7 ± 482.2, P = 0.0402) and 6 h (251.8 ± 162.4, P = 0.009) (Fig. 1C). Although levels were higher in females, the gender difference was not statistically significant (Supplementary Fig. 2A-D).
- Relative expression of PICSAR lncRNA and their receiver operating characteristic (ROC) curve in the individuals with rheumatoid arthritis compared to healthy controls. (A) Relative expression of PICSAR lncRNA in individuals with rheumatoid arthritis (n=36) compared to healthy controls (n=20) at different time points from 0 to 24 h. (B, and C) Relative expression of PICSAR lncRNA in males (n=9) and females (n=27) with rheumatoid arthritis at different time points. Data values are in the form of Mean± standard error of mean represented by bar graphs. Statistical comparisons among multiple groups were made using a one-way ANOVA (Kruskal-Wallis) test. (D) ROC curve with area under the curve (AUC) value for PICSAR lncRNA in rheumatoid arthritis. P*<0.05, **<0.01, ***<0.001. P ≤0.05 indicates a statistically significant difference.
Potential of PICSAR lncRNA as a non-invasive biomarker for RA
Receiver operating characteristic curve analysis was performed to investigate the possibility of PICSAR lncRNA as a biomarker of RA, where AUC indicates the sensitivity (true positive rate) and specificity (false positive rate) of biomarkers in diagnostic tests. The AUC value for the PICSAR lncRNA was 0.7834 (P=0.0005), with a sensitivity of 63.89 per cent and a specificity of 83.33. per cent (Fig. 1D). These results indicate that PICSAR lncRNA could be a promising biomarker for diagnosing RA in individuals.
Expression of PICSAR lncRNA is correlated with age and disease severity in female with RA
The expression of PICSAR lncRNA was markedly higher in young females, as evidenced by a notable negative correlation between the relative expression of PICSAR lncRNA and age of females at 0 h (r= -0.4173, P=0.0339), 6 h (r=-0.4193, P=0.041), 12 h (r= -0.4051, P=0.0495), and 24 h (r= -0.5084, P=0.011; Fig. 2A-D). These findings suggest that PICSAR lncRNA expression may serve as a predictor for the early onset of RA in females. Our analysis also showed a significant positive correlation between the relative expression of PICSAR lncRNA and ACR score (r=0.452, P=0.0056), indicating that PICSAR is associated with the severity of RA (Fig. 2E). Notably, this correlation was stronger in female individuals with RA (r=0.418, P=0.029) compared to male individuals (r=0.620, P=0.083), further suggesting that PICSAR may have gender-specific relevance in the severity of RA (Fig. 2F-G). However, we did not observe a significant correlation between PICSAR lncRNA and clinical markers such as RF, anti-CCP, CRP, and ESR levels (Supplementary Table III-V).
- Correlation between the relative expression of PICSAR lncRNA at (A) 0 h, (B) 6 h, (C) 12 h, and (D) 24 h and the age (yr) of females with rheumatoid arthritis. (E) Correlation of PICSAR lncRNA expression with American College of Rheumatology (ACR) scores of all the individuals with RA, (F) of males with RA, and (G) of females with RA, determined using the non-parametric Spearman test. Here, r, Spearman’s correlation coefficient, the solid line represents the linear regression of points, and dotted lines represent the 95% confidence band for their mean values. P ≤0.05 represents a statistically significant difference.
Discussion
RA is a debilitating disease characterised by joint dysfunction and increased mortality. The activation of T helper (Th) 17 cells and autoantibodies promotes inflammation and tissue damage, leading to synovitis, bone erosion, and cartilage destruction, which are key features of RA pathology4,5.
Recent studies have increasingly focused on lncRNAs, previously dismissed as transcriptional “noise” due to their lack of protein-coding capacity9-15. Numerous studies have unveiled the intricate crosstalk between lncRNAs and matrix metalloproteinases, nuclear factor-κB signalling, and T-cell response, shedding light on their role in autoimmunity, inflammation, and cancer7,8. Initially, PICSAR was shown to promote tumour-like behaviour in various cancers, by activating the ERK1/2 signalling pathway and downregulating integrins (α2β1 and α5β1), thereby facilitating cell migration and invasion10,11,16,17. In RA, this migratory and invasive behaviour may be mirrored in its effects on FLS, contributing to the characteristic joint damage and synovitis seen in the disease. In addition, lncRNA PICSAR has been shown to bind to miR-485-5p, thereby activating the TGF-β1/Smad signalling pathway, which promotes abnormal fibroblast proliferation and excessive extracellular matrix (ECM) deposition, as seen in hypertrophic scar formation18. This PICSAR-mediated activation of the TGF-β1/Smad pathway and fibroblast proliferation is particularly relevant to RA, as it may contribute to inflammation, synovial hyperplasia, and joint damage12.
While in vitro assessments of PICSAR lncRNAs have been conducted, their role as a non-invasive biomarker in RA has not been explored comprehensively. In this study, we observed significantly elevated lncRNA PICSAR in the peripheral blood of individuals with RA compared to healthy controls. Interestingly, the level of PICSAR lncRNA remained relatively stable at room temperature across various time points, spanning from 0 to 24 h, with only minor fluctuations. The consistent expression profile over different time points strengthen its potential as a biomarker. Moreover, ROC analysis demonstrated a substantial AUC value of 0.74 for PICSAR lncRNA in the serum of individuals with RA. Our results also demonstrate a significant positive correlation between the ACR score and the relative expression of PICSAR lncRNA, suggesting that PICSAR may be associated with disease progression and severity in RA. Notably, females with RA showed a particularly strong correlation between ACR scores and PICSAR lncRNA expression, underscoring the gender-specific relevance of PICSAR in RA severity. This study marks a crucial first step in establishing PICSAR lncRNA as a potential non-invasive biomarker for RA. While the findings were promising, the study was limited by a relatively small sample size and the absence of longitudinal data to assess temporal changes in PICSAR expression during disease progression or treatment.
In conclusion, our findings suggest that serum PICSAR lncRNA holds promise as a non-invasive diagnostic biomarker, with potential clinical utility in evaluating RA severity and monitoring disease progression.
Acknowledgment
Authors acknowledge all the volunteers for their participation.
Financial support & sponsorship
This study was supported by department of Science and Technology, Chandigarh administration, India (Grant number: S&T&RE/RP/F-147/Sanc/01/2022/1346-1353).
Conflicts of Interest
None.
Use of Artificial Intelligence (AI)-Assisted Technology for manuscript preparation
The authors confirm that there was no use of AI-assisted technology for assisting in the writing of the manuscript, and no images were manipulated using AI.
References
- The etiology of rheumatoid arthritis. J Autoimmun. 2020;110:102400.
- [CrossRef] [PubMed] [Google Scholar]
- Biomarkers for rheumatoid arthritis: from molecular processes to diagnostic applications-current concepts and future perspectives. Immunol Lett. 2017;189:13-8.
- [CrossRef] [PubMed] [Google Scholar]
- Role and mechanism of fibroblast-activated protein-α expression on the surface of fibroblast-like synoviocytes in rheumatoid arthritis. Front Immunol. 2023;14:1135384.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Synovial gene signatures associated with the development of rheumatoid arthritis in at risk individuals: A prospective study. J Autoimmun. 2022;133:102923.
- [CrossRef] [PubMed] [Google Scholar]
- Fibroblast-like synoviocyte metabolism in the pathogenesis of rheumatoid arthritis. Arthritis Res Ther. 2017;19:1-12.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Dysregulation of lncRNAs in rheumatoid arthritis: biomarkers, pathogenesis and potential therapeutic targets. Front Pharmacol. 2021;12:652751.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Long non-coding RNAs target pathogenetically relevant genes and pathways in rheumatoid arthritis. Cells. 2019;8:816.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Comprehensive analysis of long non-coding RNA and mRNA expression profiles in rheumatoid arthritis. Exp Ther Med. 2017;14:5965-73.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Long non-coding RNAs (lncRNAs) and their transcriptional control of inflammatory responses. J Biol Chem. 2017;292:12375-82.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Long noncoding RNA PICSAR promotes growth of cutaneous squamous cell carcinoma by regulating ERK1/2 activity. J Invest Dermatol. 2016;136:1701-10.
- [CrossRef] [PubMed] [Google Scholar]
- Long non-coding RNA PICSAR decreases adhesion and promotes migration of squamous carcinoma cells by downregulating α2β1 and α5β1 integrin expression. Biol Open. 2018;7:bio037044.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- LncRNA PICSAR promotes cell proliferation, migration and invasion of fibroblast-like synoviocytes by sponging miRNA-4701-5p in rheumatoid arthritis. EBioMedicine. 2019;50:408-20.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- ACR/EULAR 2010 rheumatoid arthritis classification criteria. Rheumatology (Oxford). 2012;51:vi5-9.
- [CrossRef] [PubMed] [Google Scholar]
- Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001;25:402-8.
- [CrossRef] [PubMed] [Google Scholar]
- Long non‐coding RNAs in development and disease: conservation to mechanisms. J Pathol. 2020;250:480-95.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Integrative analyses of transcriptome sequencing identify novel functional lncRNAs in esophageal squamous cell carcinoma. Oncogenesis. 2017;6:e297-e.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Differential expression profiles of the transcriptome in breast cancer cell lines revealed by next generation sequencing. Cell Physiol Biochem. 2017;44:804-16.
- [CrossRef] [PubMed] [Google Scholar]
- LncRNA PICSAR binds to miR-485-5p and activates TGF-β1/Smad to promote abnormal proliferation of hypertrophic scar fibroblasts (HSFs) and excessive deposition of extracellular matrix (ECM) Med Mol Morphol. 2021;54:337-45.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]