Translate this page into:
Expression levels of miRNA 22-5p and miRNA 337-5p in bladder cancer
For correspondence: Prof Mehmet Ozaslan, Department of Biology, Gaziantep University, Gaziantep 27000, Turkey E-mail: ozaslanmd@gantep.edu.tr
-
Received: ,
Accepted: ,
How to cite this article: Dagdeviren MA, Oguzkan SB, Ozaslan M, Erturhan MS. Expression levels of miRNA 22-5p and miRNA 337-5p in bladder cancer. Indian J Med Res. 2026;163:290-4. doi: 10.25259/IJMR_2226_2025.
Abstract
Background and objectives
MicroRNAs (miRNAs) are small, non-coding RNA molecules that regulate gene expression at the post-transcriptional level and play critical roles in tumour development and progression. Bladder cancer requires reliable molecular biomarkers for diagnosis and prognosis; the roles of certain miRNAs remain insufficiently explored. This study aimed to investigate the expression profiles of miR-22-5p and miR-337-5p in bladder cancer and to evaluate their associations with clinicopathological characteristics.
Methods
Paired tumour and adjacent non-tumorous bladder tissue samples were collected from 50 patients undergoing transurethral resection of bladder tumour. Quantitative PCR was performed using RNA U6 as the reference gene. Expression differences were analysed, and correlations with clinicopathological features were assessed.
Results
Both miR-22-5p and miR-337-5p were downregulated in tumour tissues compared to normal tissues. miR-22-5p expression showed a marked reduction in bladder cancer, while miR-337-5p downregulation reached borderline statistical significance. Correlation analyses revealed no association between miR-22-5p expression and clinical variables; however, miR-337-5p expression was significantly correlated with patient age and disease duration.
Interpretation and conclusions
Altered expression of miR-22-5p and miR-337-5p may contribute to bladder cancer pathogenesis. miR-22-5p appears as a potential tumour suppressor, while miR-337-5p expression is influenced by clinical parameters such as age and disease duration, highlighting their potential roles as prognostic and therapeutic biomarkers.
Keywords
Biomarker
Bladder cancer
Microrna
Mir-22-5p
Mir-337-5p
Prognosis
Bladder cancer is the ninth most common malignancy worldwide and is particularly common among men in Southern and Western Europe, North America, North Africa, and Western Asia1. Although incidence varies by geography and gender, the disease is generally more prevalent in men. According to 2022 WHO data, the incidence is 19.1 per 100,000 in Europe, 3.1 in Asia, and 10.7 in Turkey2. Bladder cancer is often diagnosed at advanced stages, limiting treatment options and complicating disease management.3 Therefore, understanding its molecular biology is essential for developing effective treatment strategies.
Recent studies have highlighted the important roles of microRNA’s (miRNAs) in cancer development and progression.4 miRNAs regulate gene expression at the post-transcriptional level and affect key cancer-related processes such as cell proliferation, apoptosis, metastasis, and epithelial–mesenchymal transition (EMT).5 EMT enables epithelial cells to gain mesenchymal features, increasing invasiveness, and is largely regulated by transcription factors such as Snail. Dysregulation of specific miRNAs has been linked to EMT activation and increased expression of EMT-related transcription factors, suggesting a relationship between miRNA expression and tumour aggressiveness.5-7
miRNAs may act as oncogenes or tumour suppressors in lung, prostate, and colorectal cancers. Similar mechanisms are being investigated in bladder cancer. They influence proliferation, invasion, metastasis, and EMT. Lamy et al8 showed that DNA copy number changes correlate with miRNA expression, while Shi et al9 reported that bladder cancer is classified as non–muscle-invasive and muscle-invasive, the latter having higher mutation burdens and poorer prognosis. Xiao et al10 found that one-third of patients develop muscle-invasive or metastatic disease, contributing to poor outcomes.10 Despite surgery and systemic therapy, recurrence rates remain high, emphasising the need for personalised approaches and early detection strategies.11 The present study investigates the regulatory levels of miR-22-5p and miR-337-5p in bladder cancer to clarify their potential roles in diagnosis and prognosis.
Methods
This study was undertaken by the Department of Urology, Gaziantep University, Turkey, and supported by the Scientific Research Projects Unit (BAP), Gaziantep University, after obtaining ethical clearance from the Institute Ethics Committee. The study was conducted in accordance with the principles of the Declaration of Helsinki, and informed consent was obtained from all participants.
Sample collection
Tissue samples were collected between October 1, 2022, and December 11, 2023, in the operating room of the Urology department, Gaziantep University Medical Faculty Research Hospital, using the Transurethral resection (TUR) procedure. A total of 100 samples were obtained, including 50 bladder tumour tissues and 50 morphologically normal (non-tumorous) bladder tissues. All samples were stained with haematoxylin–eosin and subjected to histopathological evaluation. Microscopic images of normal and tumour tissues were also documented. Microscopic examination of the tumour tissues confirmed neoplastic morphology and characteristic changes consistent with malignancy.
Analysis of miRNA expression in tissue samples
Following sample collection, all tissues were processed for RNA isolation using mechanical and enzymatic lysis methods. Amplification curves for miR-22-5p are provided in Supplementary Figure 1A for normal tissues and Supplementary Figure 1B for tumour tissues. Amplification curves for miR-337-5p are presented in Supplementary Fig. 2A for normal tissues and Supplementary Fig. 2B for tumour tissues. The box plots in Figs. 1 and 2 demonstrate that both miR-22-5p and miR-337-5p are significantly downregulated in tumour tissues compared to normal tissues.12
Raw Ct values were normalised to the endogenous control RNU6 to account for inter-sample variation, generating ΔCt values. ΔΔCt values were calculated by subtracting the ΔCt of the corresponding normal tissue from that of the tumour tissue. Relative expression (fold-change) was determined using the formula: 2-ΔΔCt. A 2^-ΔΔCq value >1 indicates upregulation in tumour tissues, whereas a value <1 indicates downregulation relative to normal tissues. This method provides a robust and quantitative assessment of differential miRNA expression. Statistical analyses were conducted on raw ΔCt values, while figures display relative expression (fold-change) values derived using the 2^-ΔΔCq method.13
- Expression levels of miR-22-5p in normal and bladder tumour tissues shown as a box plot. Data are presented as median with interquartile range.
- Expression levels of miR-337-5p in normal and bladder tumour tissues shown as a box plot. Data are presented as median with interquartile range.
RNA extraction and cDNA synthesis
Total RNA was extracted from tumour and matched normal bladder tissues. miRNA reverse transcription was performed using the A.B.T.™ miR-cDNA Synthesis Kit (A.B.T, Turkey). Each reaction contained 1 µL RNA and 9 µL synthesis mix (total 10 µL). The RT program was: 25°C for 10 min, 37°C for 20 min, 85°C for 5 min, followed by 4°C hold. qPCR was performed using SYBR Green chemistry. Primer sequences were as follows: miR-22-5p: Forward: CAGAGTTCTTCAGTGGCAAG; Reverse: GGTCCAGTTTTTTTTTTTTTTTAAAGC; miR-337-5p: Forward: CAGGAACGGCTTCATACAG; Reverse: GGTCCAGTTTTTTTTTTTTTTTAACTC; RNU6 (reference) Forward: GCAGAACGCTTCACGA; Reverse: TCCAGTTTTTTTTTTTTTTTACGCA. Each qPCR reaction (10 µL) consisted of 9 µL miR-qPCR MasterMix and 1 µL cDNA. Reactions were run on the StepOnePlus system using the following protocol: Initial denaturation: 95°C, 10 min 40 cycles: 95°C, 15 s; 60°C, 60 sec. All reactions were performed in duplicate; no-template controls were included in every run. Primer efficiencies were determined by standard curves from serial cDNA dilutions and were considered acceptable within 90-105%, in agreement with MIQE recommendations.14,15 Ct values were normalised to RNU6,16 and relative expression was calculated using the 2^-ΔΔCt method.
Statistical analysis
All statistical analyses were conducted using SPSS v25.0 (IBM Corp., Armonk, NY, USA). Paired t-tests were used to compare miRNA expression between tumour and normal tissues. Associations between miRNA expression and clinicopathological parameters were assessed using Pearson’s Chi-Square or Fisher’s Exact Test, as appropriate. Considering that seven statistical comparisons were performed for each miRNA, the Bonferroni-adjusted significance threshold was calculated as 0.05/7=0.0071. Accordingly, only results with P<0.0071 were considered statistically significant after correction.
Results
Expression levels of miRNA-22-5p and miRNA-337-5p are shown in Figures 1 and 2, respectively, as compared to healthy tissue. Relationships between the expression levels of miR-22-5p and miR-337-5p and clinical-demographic variables in bladder cancer patients are shown in Table I. No significant association was found between miR-22-5p and any variable, whereas miR-337-5p showed significant associations with age (P<0.001) and duration of diagnosis (P<0.001). These results were confirmed by Bonferroni correction ( Table II). However, for statistical analyses and graphical representations, ΔCt values (Ct_target − Ct_reference) were used because they showed a more normal distribution suitable for parametric or non-parametric tests. The ΔΔCt values were calculated to determine the relative expression differences between tumour and control tissues, and the fold change (2^−ΔΔCt) values were reported to represent the magnitude and direction of these changes. These findings suggest that miR-337-5p may have a stronger association with age and disease duration, as the increase in ΔCt values of miR-337-5p became more pronounced compared to miR-22-5p with increasing age and disease duration ( Tables III and IV). When compared with healthy tissues from the same patients, miR-22-5p was found to be significantly downregulated in tumour tissues (P<0.001), while miR-337-5p did not show a statistically significant difference (P=0.054).
| Parameter | n (%) |
|---|---|
| Age ≥55 yr | 9 (18) |
| Age≤ 55 yr | 41 (82) |
| Males | 46 (92) |
| Female | 4 (8) |
| Cigarette smoking yes | 19 (38) |
| Cigarette smokin no | 31 (62) |
| Duration of diagnosis >5 yr | 5 (10) |
| Duration of diagnosis <5 yr | 45 (90) |
| Existing diseases yes | 27 (54) |
| Existing diseases no | 23 (46) |
| Tumour stage high | 29 (58) |
| Tumour stag low | 21 (42) |
| Tumour invasive | 19 (38) |
| Tumour noninvasive | 31 (62) |
|
Variable |
miR-22 | miR-337-5p | ||
|---|---|---|---|---|
| P value | After correction | P value | After correction | |
| Age | 0.180 | Not significant | 0.001 | Significant |
| Gender | 0.673 | Not significant | 0.463 | Not significant |
| Cigarette | 0.761 | Not significant | 0.763 | Not significant |
| Diagnosis duration | 0.279 | Not significant | 0.001 | Significant |
| Existing diseases | 0.273 | Not significant | 1.417 | Not significant |
| Tumour stage | 0.186 | Not significant | 0.150 | Not significant |
| Tumour spread | 4.401 | Not significant | 2.668 | Not significant |
| Age (yr) | Total | P | |||
|---|---|---|---|---|---|
| ≥55 | <55 | ||||
| miR-22_5p expression | Low | 29 | 8 | 37 | 0.190 |
| High | 12 | 1 | 13 | ||
| miR-337_5p expression | Low | 27 | 6 | 33 | 0.001 |
| High | 14 | 3 | 17 | ||
| Diagnosis duration | Total | P | |||
|---|---|---|---|---|---|
| <5 yr | >5 yr | ||||
| miR-22_5p expression | Low | 32 | 5 | 37 | 0.279 |
| High | 12 | 1 | 13 | ||
| miR-337_5p expression | Low | 30 | 4 | 34 | 0.001 |
| High | 14 | 2 | 16 | ||
Discussion
The present study focused on miR-22-5p and miR-337-5p, two miRNAs with tumour-suppressive roles in various cancers but insufficiently explored in bladder cancer.17 Previous studies indicate that miR-22 regulates chemoresistance and inhibits EMT, suggesting that its loss may contribute to tumour progression.18 miR-22-5p downregulation has been documented in hepatocellular, breast, and colorectal cancers, where it is associated with poor outcomes.19,20 Similarly, miR-337-5p functions as a tumour suppressor in gastric, pancreatic, and lung cancers.21-24 Reduced miR-337-5p promotes invasion and metastasis, partly through dysregulation of oncogenic pathways such as STAT3 and HOXB7. Despite these findings, data on miR-337-5p in bladder cancer are limited, making the present results an important early contribution.25
Consistent with reports from other tumour types, miR-22-5p was significantly downregulated in bladder cancer tissues. miR-337-5p also showed reduced expression, although with borderline statistical significance. This variability suggests that miR-337-5p expression may depend on tumour-specific molecular features. A review by Yarahmadi et al26 reported strong anti-proliferative and anti-metastatic functions for the miR-337 family, supporting our observations.27 Analyses of clinical and demographic variables revealed no significant associations for most parameters, including smoking status, tumour stage, and metastasis.28 However, miR-337-5p expression showed a meaningful relationship with age, with lower levels observed in patients aged ≥55 years. Aging-related genetic and epigenetic changes likely contribute to this pattern.29,30 After Bonferroni correction, the associations between miR-337-5p and both age and disease duration remained statistically significant, confirming the robustness of the findings.
Overall, the findings support tumour-suppressive roles for miR-22-5p and miR-337-5p in bladder cancer, with stronger evidence for miR-22-5p.31 Further functional studies are needed to clarify the molecular mechanisms regulated by these miRNAs and to examine their potential as biomarkers and therapeutic targets.
Acknowledgment
The authors acknowledge the Scientific Research Projects Unit (BAP) of Gaziantep University.
Author contributions
MAD: Design literature, clinical studies, data analysis, manuscript writing; SBO: Concepts design, literature search; MO: Experimental status, data analysis, statistical analysis, manuscript writing; MSE: Clinical studies, literature search, manuscript writing. Authors have read and approved the final printed version of the manuscript.
Financial support and sponsorship:
None.
Conflicts of Interest
None.
Use of Artificial Intelligence (AI)-Assisted Technology for manuscript preparation
The authors confirm that there was no use of AI-assisted technology for assisting in the writing of the manuscript and no images were manipulated using AI.
References
- Bladder cancer incidence and mortality: A global overview and recent trends. Eur Urol.. 2017;71:96-108.
- [CrossRef] [PubMed] [Google Scholar]
- International Agency for Research on Cancer. World Health Organization. Globocan 2022. Cancer Today. Available from: https://gco.iarc.who.int/today, accessed on December 10, 2025.
- Bladder cancer. In: Schottenfeld D, Fraumeni JF Jr, eds. Cancer Epidemiology and Prevention (4th ed). Oxford: Oxford University Press; 2017. p. :977-96.
- [Google Scholar]
- MiR-22 suppresses epithelial–mesenchymal transition in bladder cancer by inhibiting Snail and MAPK1/Slug/vimentin feedback loop. Cell Death Dis. 2018:9.
- [Google Scholar]
- A uniform system for microRNA annotation. RNA.. 2003;9:277-9.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- The nuclear RNase III Drosha initiates microRNA processing. Nature.. 2003;425:415-9.
- [CrossRef] [PubMed] [Google Scholar]
- MicroRNA-5p and -3p co-expression and cross-targeting in colon cancer cells. J Biomed Sci.. 2014;21:95.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Are microRNAs located in genomic regions associated with cancer. Br J Cancer.. 2006;95:1415-18.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- FGFR3 mutational activation can induce luminal-like papillary bladder tumour formation and favors a male sex bias. Eur Urol.. 2023;83:70-81.
- [CrossRef] [PubMed] [Google Scholar]
- miR-22-3p enhances multi-chemoresistance by targeting NET1 in bladder cancer cells. Oncol Rep.. 2018;39:2731-40.
- [CrossRef] [PubMed] [Google Scholar]
- TRPM2-AS promotes bladder cancer by targeting miR-22-3p and regulating GINS2 mRNA expression. Onco Targets Ther.. 2021;14:1219-37.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Micro-RNA profiling in kidney and bladder cancers. Urol Oncol.. 2007;25:387-92.
- [CrossRef] [PubMed] [Google Scholar]
- Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods.. 2001;25:402-8.
- [CrossRef] [PubMed] [Google Scholar]
- The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem.. 2009;55:611-22.
- [CrossRef] [PubMed] [Google Scholar]
- Use of UV methods for measurement of protein and nucleic acid concentrations. Biotechniques.. 1996;20:968-70.
- [CrossRef] [PubMed] [Google Scholar]
- Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques.. 2004;37:112-4.
- [CrossRef] [PubMed] [Google Scholar]
- Regulatory mechanisms of microRNA expression. J Transl Med.. 2016;14:143.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- A day in the life of the spliceosome. Nat Rev Mol Cell Biol.. 2014;15:108-21.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- snRNAs as the catalysts of pre-mRNA splicing. Curr Opin Chem Biol.. 2005;9:603-8.
- [CrossRef] [PubMed] [Google Scholar]
- The expression and regulation of microRNA-125b in cancers. Acta Biochim Biophys Sin (Shanghai).. 2013;45:803-5.
- [CrossRef] [PubMed] [Google Scholar]
- Tumour-initiating cell-specific miR-1246 and miR-1290 expression promote non-small cell lung cancer progression. Nat Commun.. 2016;7:11702.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- miR-337 regulates proliferation and invasion in pancreatic ductal adenocarcinoma by targeting HOXB7. Diagn Pathol.. 2014;9:171.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- MiR-337 suppresses pancreatic cancer development via STAT3/Wnt/β-catenin axis. Anticancer Drugs.. 2021;32:681-92.
- [CrossRef] [PubMed] [Google Scholar]
- Identification of novel microRNA targets based on microRNA signatures in bladder cancer. Int J Cancer.. 2009;125:345-52.
- [CrossRef] [PubMed] [Google Scholar]
- A review on expression and regulatory mechanisms of miR-337-3p in cancer. J Biomol Struct Dyn.. 2025;43:7432-41.
- [CrossRef] [PubMed] [Google Scholar]
- The array of outcomes associated with mindfulness interventions in schools: A systematic review and meta-analysis. Mindfulness. 2025:1-24.
- [Google Scholar]
- Association between smoking and risk of bladder cancer among men and women. JAMA.. 2011;306:737-45.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- The role of microRNAs in cancer: Diagnostic and prognostic biomarkers and targets of therapies. Expert Opin Ther Targets.. 2012;16:S103-9.
- [CrossRef] [PubMed] [Google Scholar]
- Circulating miR-21, miR-29a, and miR-126 are associated with premature death risk due to cancer and cardiovascular disease: The JACC study. Sci Rep.. 2021;11:5298.
- [CrossRef] [PubMed] [PubMed Central] [Google Scholar]
- Clinical utility of miR-143, miR-145 and miR-224 for predicting survival of bladder cancer patients following treatment. Carcinogenesis.. 2015;36:528-37.
- [CrossRef] [PubMed] [Google Scholar]