Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
View/Download PDF

Translate this page into:

Correspondence
151 (
2-3
); 251-254
doi:
10.4103/ijmr.IJMR_671_20

Development of in vitro transcribed RNA as positive control for laboratory diagnosis of SARS-CoV-2 in India

Influenza Group, ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India
Electron Microscopy & Pathology Group, ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India
Bioinformatics & Data Management Group, ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India
ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India

*For correspondence: potdarvarsha9@gmail.com

Licence

This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.

Disclaimer:
This article was originally published by Wolters Kluwer - Medknow and was migrated to Scientific Scholar after the change of Publisher.

Sir,

The WHO has recommended reverse transcription-polymerase chain reaction (RT-PCR) for the confirmation of coronavirus disease 2019 (COVID-19) diagnosis. Real-time RT-PCR assays with automated extraction systems are required to process large numbers of specimens. Corman et al1 have reported three real-time RT-PCR assays [based on the RNA-dependent RNA polymerase (RdRp) gene, envelope (E) gene and nucleocapsid (N) gene] for detecting beta coronaviruses, including severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)1, and additionally, Chu et al2 have reported two real-time RT-PCR assays based on ORF 1b and N gene that are highly conserved among Sarbeco viruses.

At the Indian Council of Medical Research-National Institute of Virology (ICMR-NIV), Pune, we adopted a real-time RT-PCR assay for screening (E gene assay) and confirmation (RdRp, N and ORF gene)1 along with housekeeping Rnase P gene. Sequences and source of primers and probes used in this study are given in the Table, and the performance of screening assay was assessed using in vitro transcribed (IVT) RNA for SARS-CoV-2 targeting E gene, whereas the confirmatory RdRp assay used purified RNA of SARS-coronavirus Frankfurt 1 strain. Limited supply of positive controls was available from the WHO from Charité Laboratories, Berlin, via European Virus Archive Global (EVAg). A need was sensed to provide positive control to all laboratories in the national network of Viral Research and Diagnostic Laboratories (VRDLs) for real-time RT-PCR. Thus, positive controls for the screening and confirmatory assays were generated in-house.

Table Primer and probe sets used in this study
Assay type Name Sequence (5’- 3’)
E gene screening assay E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA
E_Sarbeco_P1 FAM-ACACTAGCATCCTTACTGCGCTTCG-BHQ
RNase P gene (internal control) screening assay RNaseP -F1 AGATTTGGACCTGCGAGCG
RNaseP -R1 GAGCGGCTGTCTCCACAAGT
RNaseP -P1 FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ
RdRp gene confirmatory assay RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA
RdRP_SARSr-P2 (Specific for Wuhan-CoV) FAM-CAGGTGGAACCTCATCAGGAGATGC-QSY
HKU ORF gene confirmatory assay HKU-ORF1b-nsp14F TGGGGYTTTACRGGTAACCT
HKU-ORF1b-nsp14 R AACRCGCTTAACAAAGCACTC
HKU-ORF1b-nsp14 P FAM-TAGTTGTGATGCWATCATGACTAG-QSY

Source: Eurofins Genomics India Pvt. Ltd., Bengaluru; Invitrogen, USA

Using whole-genome sequence of the first Indian COVID-19 case, forward primers with T7 promoter tag at the 5´ end, were designed to amplify full-length E gene, N gene and partial RdRp and ORF 1b regions. Gene-specific PCR was carried out to amplify the desired PCR product. Amplicons were purified using Qiagen direct PCR purification kit (Qiagen, Hilden, Germany). IVT was synthesized using T7 Riboprobe (Promega, USA) as per the kit protocol. Ten-fold serial dilutions of each transcribed RNA products were tested with respective gene primer probe sets for specific detection and limit of detection.

Gene-specific desired amplification was also observed in conventional RT-PCR (E: 550 bp, N: 1254 bp, RdRP: 344, ORF: 388) (Fig. 1). Further, the IVT RNA of each gene was serially diluted 10-fold (101 to 1010), and the performance was tested with gene-specific primer probe by real-time RT-PCR. All the transcribed RNA showed amplification with specific primer probe. The limit of detection for E gene was 106 yielding a cycle threshold (Ct) at cycle 29, RdRP (p1) was 105 with 27 Ct, RdRp (p2) was 106 with 29 Ct and ORF 1b106 with 28 Ct, whereas N gene showed 103 with 25 Ct (Fig. 2A-E).

Positive DNA amplification of envelope (E), RNA-dependent RNA polymerase (RdRp), nucleocapsid (N) and open reading frame (ORF) 1b-nsp14 for in vitro transcribed preparation. Lane 1: E gene (550 bp), lane 2: RdRp gene (344 bp), lane 3: N gene (1254 bp) positive, lane 4: ORF (388 bp), lane 5: 100 bp DNA ladder.
Fig. 1 Positive DNA amplification of envelope (E), RNA-dependent RNA polymerase (RdRp), nucleocapsid (N) and open reading frame (ORF) 1b-nsp14 for in vitro transcribed preparation. Lane 1: E gene (550 bp), lane 2: RdRp gene (344 bp), lane 3: N gene (1254 bp) positive, lane 4: ORF (388 bp), lane 5: 100 bp DNA ladder.
(A-E) Multicomponent amplification graph for 10-fold dilutions of in vitro transcribed RNA: (A) E gene, (B) RdRp gene probe 1, (C) RdRp gene probe 2, (D) ORF gene, (E) N gene. The X axis represents number of cycles and Y axis represents amount of fluorescence.
Fig. 2 (A-E) Multicomponent amplification graph for 10-fold dilutions of in vitro transcribed RNA: (A) E gene, (B) RdRp gene probe 1, (C) RdRp gene probe 2, (D) ORF gene, (E) N gene. The X axis represents number of cycles and Y axis represents amount of fluorescence.

When the assay was first set up at the National Influenza Centre of ICMR-NIV, Pune, the IVT RNA for E and SARS coronavirus Frankfurt 1 strain were received from EVAg. The real-time PCR screening assay (E gene) was also established at the 13 VRDLs as part of ICMR's efforts to expand testing to VRDLs closer to major airports3. However, due to screening of low number of samples, the repeated use of positive controls was made. The supply of IVT RNA as positive control for E gene from EVAg was limited and had non-consistent performance when diluted further. In addition, the control for RdRp assay was from a SARS coronavirus Frankfurt 1 isolate, which yielded weak signal with RdRp Wuhan-specific probe. This necessitated the development of an indigenous IVT RNA for E and RdRp. In addition, majority of the WHO screening protocols (5 of 6) are based on N gene targeting different nucleotide positions and require multiple specific positive controls4. Hence, an IVT RNA was designed for entire N gene which would be compatible for multiple protocols.

We demonstrated the successful use of IVT RNA for N gene recommended in various protocols available on WHO site. The partial RdRp IVT RNA worked well with both the RdRp probes described in Charité, Berlin, Germany5, especially Wuhan-specific RdRp probe 2, which could be used as confirmatory test. All the IVT RNA had good yield and performed well with specific primer probe.

In conclusion, gene-specific IVT RNA was synthesized for all the gene targets used in real time PCR. These IVTs were used effectively by all VRDLs as positive control. Successful establishment of diagnostic system including in-house positive control was beneficial to provide timely diagnosis and accelerate clinical management and isolation of SARS-CoV-2 patients and to control further spread.

Acknowledgment

Authors acknowledge the National Influenza Centre staff: Drs S. Bharadwaj, R. Ghug, Ms U. Saha, Servshri H. Kengle, A. Awhale, Dr V. Malik, Ms A. Jagtap, Shri A. Gondhalikar, Ms S. Digraskar, Ms P. Malsane, Shri V. Awatade, Ms S. Bhorekar, Dr S. Salve, Ms P. Shinde and Dr B. Nimhas.

Financial support & sponsorship: Authors acknowledge the Department of Health Research, Ministry of Health & Family Welfare, Government of India, New Delhi, for financial support

Conflicts of Interest: None.

References

  1. , , , , , , . Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill 2020:25. pii: 2000045
    [Google Scholar]
  2. , , , , , , . Molecular diagnosis of a novel coronavirus (2019-nCoV) causing an outbreak of pneumonia. Clin Chem 2020 pii: Hvaa02920200117
    [Google Scholar]
  3. . Establishment of a network of laboratories for managing epidemics and natural calamities (VRDL). Available from: https://dhr.gov.in/schemes/esablishment-network-laboratories-managing-epidemicsand-natural-calamities
  4. . . Laboratory testing for 2019 novel coronavirus (2019-nCoV) in suspected human cases. WHO; Available from: https://wwwwhoint/publications-detail/laboratory-testing-for-2019-novel-coronavirus-in-suspected-human-cases-20200117
  5. . . Coronavirus disease (COVID-19) technical guidance: Laboratory testing for 2019-nCoV in humans. WHO; Available from: https://wwwwhoint/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance

    Fulltext Views
    1,161

    PDF downloads
    556
    View/Download PDF
    Download Citations
    BibTeX
    RIS
    Show Sections
    Scroll to Top