Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
View/Download PDF

Translate this page into:

Original Article
139 (
3
); 431-437

Association of Malassezia species with dandruff

Department of Medical Microbiology, Postgraduate Institute of Medical Education & Research, Chandigarh, India
Department of Dermatology, Venerology & Leprosy, Postgraduate Institute of Medical Education & Research, Chandigarh, India
Department of Microbiology, Kasturba Medical College, Manipal, India

Reprint requests: Dr Shivaprakash M. Rudramurthy, Additional Professor, Mycology Division, Department of Medical Microbiology Postgraduate Institute of Medical Education & Research, Chandigarh 160 012, India e-mail: mrshivprakash@yahoo.com

Licence

This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Disclaimer:
This article was originally published by Medknow Publications & Media Pvt Ltd and was migrated to Scientific Scholar after the change of Publisher.

Abstract

Background & objectives:

Malassezia species implicated with dandruff vary at different geographical locations. The present study was conducted to determine the spectrum and distribution of Malassezia species in dandruff patients and healthy individuals.

Methods:

Patients with dandruff from northern (Chandigarh) and southern (Manipal, Karnataka) parts of India (50 each) and healthy individuals (20) were included in the study. Dandruff severity was graded as mild, moderate and severe. Malassezia spp. isolated were quantified and identified by phenotypic characters and molecular methods including PCR-RFLP and DNA sequencing.

Results:

Number of Malassezia spp. retrieved was significantly higher (P<0.001) in dandruff cases (84%) as compared to healthy individuals (30%). Isolation of Malassezia spp. was significantly higher (P<0.01) in patients from southern India. In moderately severe cases M. restricta was single most predominant (37.8%) isolate from patients of northern part of India and M. furfur (46.4%) from patients of southern part of India. Malassezia density was significantly associated with the severity of dandruff (P<0.001).

Interpretation & conclusions:

Our results on a limited number of individuals show that Malassezia spp. associated with dandruff varies in different regions of the country and the density of yeasts increases with severity of disease.

Keywords

Dandruff
epidemiology
Malassezia
molecular identification

Dandruff is a common persistent, relapsing inflammatory condition affecting the areas rich in sebaceous glands1. The condition is characterized by the flaky white to yellowish scales seen on the scalp and less frequently on the nasolabial folds, behind the ears, eyebrows, and intertriginous areas. The prevalence of dandruff in population varies between 30-95 per cent2. Besides the discomfort, this disorder is also socially embarrassing and affects the self esteem of the patient3. Malassezia species play a role in pathogenesis of this condition along with stress, fatigue, weather extremes, oily nature of skin, use of shampoos, immunosuppressed status (AIDS), and neurological disorders. M. restricta and M. globosa are generally considered to be the causative agents of dandruff4; the species implicated vary depending on geographical location of the host. M. furfur, M. sympodialis, M. obtusa, and M. slooffiae are the other species associated with this condition5. Though cases of dandruff are widely prevalent in India3, the prevalence of this disease, associated factors including Malassezia species are not studied in Indian population. The present study was conducted to determine the spectrum of Malassezia spp. causing dandruff and existing as commensal on the scalp of healthy individuals at two geographical locations (northern and southern parts of India). In addition, features associated with dandruff were also studied.

Material & Methods

This study was conducted in the departments of Medical Microbiology and Dermatology, Venerology & Leprosy, Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh in collaboration of department of Microbiology, Kasturba Medical College, Manipal, Karnataka, India.

One hundred patients (50 each from northern and southern part of India) and 20 healthy individuals (10 each from northern and southern part of India) without features of dandruff (controls) were enrolled in this study. The study was conducted during September 2011 to August 2012. Based on the presence or absence of visible flakes over the scalp, the study population was categorized as dandruff patients or healthy individuals, respectively. The dandruff patients were defined as individuals having inflammation of the scalp in the form of red, scaly, itchy and flaking rash2. The study protocol was approved by the Institute's Ethics Committee of PGIMER, Chandigarh. The samples were collected after obtaining written informed consent of the patients. Study area was elected on the basis of convenience to perform field study. The patients from northern part of India belonged to two villages viz., Dhuhar (total population ~2500) and Nial (total population ~2400) of Punjab State, whereas patients from southern part of India belonged to two villages viz., Karki (total population ~2800) and Manki (total population 3000) of coastal Karnataka. The distance between the two study areas is approximately 2000 km. The climate of chosen area in southern part of India is hot with high humidity almost all through the year (temperature ~22-35°C, humidity ~65-90%), northern part of India is dry and hot (temperature ~35-45°C, humidity ~40-45%) in summer and cold (temperature ~5-15 °C, humidity ~70-80%) in winter. Sampling was carried out at convenience by random screening for the dandruff cases in the selected villages. Both children and adults (3-50 yr) were included in the study. On the day of sampling, the participants were advised not to wash their scalp. Patients and controls applying topical antifungals and/or steroid to the scalp preceding a month of sampling were not enrolled. The scalp hair were categorized as either oily or dry on visual observation. Hair fall of the patients was recorded as mild, moderate and excess on the basis of self assessment of the patients. In addition, use of cleansing agents (bath soap or shampoo), applying/not applying oil to the scalp, type of oil applied and its frequency were recorded. Dandruff severity was graded as mild, moderate and severe on the basis of size, colour and surface of the flakes or scales. The severity score was defined as mild (score up to 24), moderate (25-60) and severe (>60) dandruff67.

Samples were collected from relatively severely affected areas of the patients. Flakes or scales were collected by partitioning the hair with a sterile comb and scrapping approximately one inch area using blunt scalpel. In healthy individuals, the scrapings were collected from vertex and temporal regions. The samples were inoculated over the surface of modified Dixon's agar slants8, transferred to the laboratory on the same day and incubated at 30°C in a humid chamber up to four weeks. Colonies appearing like Malassezia were counted depending on the growth rate. Malassezia species isolated from southern region (Kasturba Medical College, Manipal) were transferred to PGIMER, Chandigarh for identification. At PGIMER all the isolates were identified on the basis of macroscopic and microscopic features (Fig. 1), biochemical, and physiological tests89.

Photomicrographs of different Malassezia species stained by methylene blue. (a) M. furfur; (b) M. globosa; (c) M. restricta; (d) M. slooffiae; and (e) M. sympodialis. Magnification 1000X.
Fig. 1
Photomicrographs of different Malassezia species stained by methylene blue. (a) M. furfur; (b) M. globosa; (c) M. restricta; (d) M. slooffiae; and (e) M. sympodialis. Magnification 1000X.

The identity of the isolates were further confirmed by PCR-RFLP (restriction fragment length polymorphisms) of ITS2 (internal transcribed spacer 2) region rDNA gene and DNA sequencing of 26s region of rDNA gene1011. Standard strains of M. furfur (Microbial Type Culture Collection, Institute of Microbial Technology, Chandigarh, India, MTCC-1374), M. restricta (The Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands, CBS-7877), M. obtusa (CBS–7876), M. globosa (CBS-7966), M. pachydermatis (CBS–1879), M. slooffiae (CBS-7956), M. sympodialis (CBS-7222), M. japonica (CBS-9348), M. yamatoensis (CBS-9725) were used as controls. Genomic DNA isolation was performed by microwave irradiation technique12. Briefly, a colony of Malassezia yeast was transferred to a PCR tube and warmed three times for one minute each in a microwave. The supernatant was used as template for PCR analysis. For PCR- RFLP, amplification was done using the primers ITS3 (5’ GCATCGATGAAGAACGCAGC 3’) and ITS4 (5’ TCCTCCGCTTATTGATATGC 3’) (Sigma, Banglore). Enzymatic digestion was carried out using three restriction enzymes viz. Alu1, Ban1 and MspA1 (New England Biolabs, Ipswich, USA). The amplicons and enzyme mixture was incubated at 37°C for three hours. For each digestion reaction 12.5 μl of PCR product, 1.5 μl buffers and 1μl of corresponding enzyme were added. For each species, three separate reaction mixtures were made using three different restriction enzymes. The restriction patterns of clinical isolates were compared with band pattern of the standard strains of Malassezia (Table I and Fig. 2). Sequencing of the 26S rDNA was done by amplifying this region with universal primers NL-1 (5’-GCATATCAATAAGCGGAGGAAAAG) and NL-4 (5’-GGTCCGTGTTTCAAGACGG)11. Purification of amplified gene product was performed by gel extraction kit (QIAquick, Quiagen, Bangalore). The elute was used as the purified gene product for sequencing PCR. Sequencing PCR was performed for both the strands using above mentioned primers and Big Dye Terminator Cycle Sequencing Kit, Version 3.1 (Applied Biosystems, USA). All the sequencing reactions were purified and analyzed on ABI 3130 Genetic Analyzer (Applied Biosystems, USA). For each isolate, the consensus sequences were prepared from the sequence obtained by forward and reverse primers using Bionumerics software (version 6.5, Applied Maths, Ghent, Belgium). The consensus sequences were compared with the sequences of the GenBank DNA database (http://www.ncbi.nlm.nih.gov/Genbank/index.html) and CBS-KNAW fungal biodiversity centre database (http://www.cbs.knaw.nl/).

Table I Amplified product size (bp) and expected length of restriction fragments (bp) obtained after digesting with different restriction enzymes
Agrose gel picture of PCR-RFLP profiles of few Malassezia species after digestion with restriction enzymes- AluI, BanI, MspAI.
Fig. 2
Agrose gel picture of PCR-RFLP profiles of few Malassezia species after digestion with restriction enzymes- AluI, BanI, MspAI.

Statistic analysis: Comparison of Malassezia spp. distribution based on severity, hair type and hair fall in different groups (mild, moderate and severe) of dandruff patients was done by Chi-squared test (Software- Epi Info™ 7.1.0.6 and OpenEpi version 2.3, Rolin School of Public Health, Emory University, Antlanta, Georgia, www.Openepi.com).

Results

Age of the patients varied between 3 and 50 years. Forty per cent of the patients were in the age range of 10 and 19 years and 34 per cent were between 20 and 29 years. Females were 61 per cent and males 39 per cent. Malassezia culture positivity rate was significantly higher in patients from southern India, compared to northern India (47 cases vs. 37 cases; P<0.01). M. furfur and M. restricta were isolated in significantly higher number (P<0.05) from patients of southern part of India as compared to patients from northern part of India (Table II). Of the 20 healthy individuals, Malassezia species could be isolated from 6 (30%) individuals from southern India, of whom 5 were M. furfur and one was M. slooffiae. None of the samples collected from the healthy individuals of northern India yielded Malassezia. The average number of colonies isolated from mild, moderate and severe dandruff cases from northern part of India was 4.5, 10.6 and 14.4 cfu, respectively, whereas from healthy individuals, mild and moderate dandruff cases of southern India was 6, 24 (samples from 5 patients had confluent growth and the colonies could not be counted) and 24 cfu (samples from 12 patients showed confluent growth), respectively. Isolation of Malassezia spp. among dandruff patients and healthy individuals using different cleansing agent and application of oil is given in Table III.

Table II Distribution of Malassezia spp. among dandruff patients according to geographical location, hair fall and severity
Table III Isolation of Malassezia spp. among dandruff patients and healthy individuals

In northern India, M. globosa and M. restricta were isolated from all the age groups studied. In patients of southern India, M. furfur, M. globosa and M. restricta were almost equally distributed among all the age groups. Although statistically insignificant, in population of northern India, M. restricta was associated more in males (48%) and M. globosa in females (43%). In patients from southern India, M. furfur was predominantly isolated from male patients (60%) and mixture of M. globosa and M. restricta from females (32%). M. restricta was significantly isolated from majority (44.5%) of the patients having oily hair. The details of distribution of Malassezia spp. according to geographical location, hair fall and severity are given in Table II.

All the isolates were identified by the band pattern obtained after PCR-RFLP of ITS2 region and 37 of them were subjected to DNA sequencing. Representative sequences of the isolates are deposited in the GenBank database with the accession numbers JN651930 to JN651965 and JN642245. The isolates have been deposited at the National Culture Collection of Pathogenic Fungi, PGIMER, Chandigarh, India.

Discussion

In the present study, two geographically different locations were studied. Geographically, northern and southern regions of India are distinct in terms of environmental conditions. M. restricta and M. globosa were the two most prevalent species isolated from dandruff patients of northern India having moderate to severe lesions while M. furfur, M. restricta and M. globosa were either isolated singly or in mixture from patients from southern India. In Japan and USA, M. globosa is most frequently isolated from dandruff cases followed by M. restricta13. Whereas M. furfur and M. slooffiae are isolated from scalp of healthy individuals and are considered as commensal species. In the present study, the sample collection was carried out during the winter season (usually dry) from northern part of India and in summer from coastal region of southern India, which is humid

(~ 65-90%) all through the year. According to Pierard-Franchimont et al14 the severity of dandruff may fluctuate with seasons and often worsens in winter. High humidity may be the reason for occurrence of less severe cases from coastal part of southern India as compared to dry weather during winter in northern part of India. In addition, application of coconut oil in majority of the southern India patients (90%) might have prevented severe cases.

The isolation rate of Malassezia spp. is known to be highest in the age group of around twenty years when sebaceous glands activity is maximum15. Similar to the findings of Lee et al16, in the present study no significant age dependent variation of Malassezia species was noticed. This could be due to the relatively small number of the participants in our study.

Recovery of Malassezia species in culture usually depends on the culture medium and techniques used for its isolation. In a culture dependant study from Canada, Malassezia recovery rate was 82 per cent17. Similar studies from Sweden and Japan showed far less recovery rate. M.restricta was not isolated from any of these studies1819. Tajima et al20 by using culture independent molecular technique showed that M. globosa and M. restricta were predominantly associated both with lesional and non-lesional area of Japanese SD/D patients. In the present study, isolation rate of Malassezia spp. was 74 per cent in northern India and 94 per cent from southern India patients.

Though association of dandruff is related to the species of Malassezia implicated, presence of this yeast in high number is also related in causation of dandruff. In a culture dependant study, Gupta et al17 showed higher number of Malassezia colony at non-lesional site than on the lesional site. But, in DNA based study Malassezia found at lesional site was higher in density than on non-lesional site20. In a few reports the quantity of yeasts was not found to be correlate positively with the severity of the disease421. In the present study, the higher colony count positively associated with the severity of dandruff. It is also important to note that accurate quantification of Malassezia on the scalp is difficult to perform as the Malassezia resides along with sebum at infandibulum of the hair follicle2223. Hence possibly culture based technique is better than DNA based non-culture technique, as in the later only the surface of the skin is sampled without including hair infundibulum. Another disadvantage of DNA based non-culture technique is that the DNA from both viable and nonviable cells are amplified.

In our study, M. restricta was recovered from individuals having any type of hair (oily and dry). Severe hair loss was associated more with M. restricta and M. globosa than other Malassezia species, but the difference was not significant. This finding was in agreement with the study of Nematian et al24 where increased hair loss was shown to be associated with Pityrosporum ovale (M. globosa). Malassezia may cause hair loss by utilizing the lipids present in different strata of epidermis and dermis leading to weakening of hair root and hair fall2526.

The major difficulty while conducting epidemiological studies on Malassezia associated disease is its isolation due to slow growing nature of this agent. A few species like M. globosa, M. restricta and M. obtusa take longer than a month to grow in sufficient amount to extract the DNA by phenol-chloroform extraction technique. In the present study, we used the rapid method of template preparation from the Malassezia colonies using microwave irradiation12. This technique is rapid, reliable, cost-effective, and simple. This technique could also be applied to amplify the DNA from a single isolated colony during the co-existence of multiple Malassezia species in a given culture.

In conclusion, M. globosa and M. restricta seemed to be the predominant species causing dandruff in Indian population and high density of these species on the scalp was related with the severity of dandruff. Small sample size was a major limitation of the present study. Such studies need to be done at various geographic locations in India with large carefully drawn sample.

Acknowledgment

Authors acknowledge the Indian Council of Medical Research, New Delhi, India for financial assistance. Authors also acknowledge Dr P.V.M. Lakshmi, Department of Community Medicine, PGIMER, Chandigarh and Shri Kapil Mukesh for their help in analysis and sample collection respectively.

References

  1. , , . Dandruff and seborrhoeic dermatitis: causes and management. Clin Exp Dermatol. 1997;22:3-6.
    [Google Scholar]
  2. , , , , , , . Dandruff-associated Malassezia genomes reveal convergent and divergent virulence traits shared with plant and human fungal pathogens. Proc Natl Acad Sci USA. 2007;104:18730-5.
    [Google Scholar]
  3. , , . A new postulate on two stages of dandruff: a clinical perspective. Int J Trichol. 2011;3:3-6.
    [Google Scholar]
  4. , . Malassezia species and seborrheic dermatitis. Folia Med (Plovdiv). 2009;51:23-33.
    [Google Scholar]
  5. , , , , , . Skin diseases associated with Malassezia species. J Am Acad Dermatol. 2004;51:785-98.
    [Google Scholar]
  6. , , . The antidandruff efficacy of a shampoo containing piroctone olamine and salicylic acid in comparison to that of a zinc pyrithione shampoo. Int J Cosmet Sci. 2000;22:285-9.
    [Google Scholar]
  7. , . Evaluation of efficacy of antidandruff agents. J Soc Cosmet Chem. 1981;32:327-38.
    [Google Scholar]
  8. , , , . The genus Malassezia with description of four new species. Antonie Van Leeuwenhoek. 1996;69:337-55.
    [Google Scholar]
  9. , , , , , , . The role of Malassezia species in the ecology of human skin and as pathogens. Med Mycol. 1998;36(Suppl 1):220-9.
    [Google Scholar]
  10. , , , . Verifiable single nucleotide polymorphisms of the internal transcribed spacer 2 region for the identification of 11 Malassezia species. J Dermatol Sci. 2006;43:214-7.
    [Google Scholar]
  11. , , . Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5’ end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol. 1997;35:1216-23.
    [Google Scholar]
  12. , , , , , , . The application of colony PCR in the molecular biological analysis of Malassezia yeasts. Korean J Med Mycol. 2007;12:180-8.
    [Google Scholar]
  13. , , . Epidemiology of Malassezia-related skin diseases. In: , , , , eds. Malassezia and the skin. Berlin, Heidelberg: Springer-Verlag; . p. :65-120.
    [Google Scholar]
  14. , , , . Seasonal modulation of sebum excretion. Dermatologica. 1990;181:21-2.
    [Google Scholar]
  15. , , , , , , . Quantitative analysis of the cutaneous Malassezia microbiota in 770 healthy Japanese by age and gender using a real-time PCR assay. Med Mycol. 2010;48:229-33.
    [Google Scholar]
  16. , , , , , , . Distribution of Malassezia species on the scalp in korean seborrheic dermatitis patients. Ann Dermatol. 2011;23:156-61.
    [Google Scholar]
  17. , , , , . Quantitative culture of Malassezia species from different body sites of individuals with or without dermatoses. Med Mycol. 2001;39:243-51.
    [Google Scholar]
  18. , , , . Identification of Malassezia species isolated from patients with seborrhoeic dermatitis, atopic dermatitis, pityriasis versicolor and normal subjects. Med Mycol. 2000;38:337-41.
    [Google Scholar]
  19. , , , , , , . The prevalence of Malassezia yeasts in patients with atopic dermatitis, seborrhoeic dermatitis and healthy controls. Acta Derm Venereol. 2005;85:17-23.
    [Google Scholar]
  20. , , , , . Molecular analysis of Malassezia microflora in seborrheic dermatitis patients: comparison with other diseases and healthy subjects. J Invest Dermatol. 2008;128:345-51.
    [Google Scholar]
  21. , , , , , . Seborrheic dermatitis and malignancy. An investigation of the skin flora. Acta Derm Venereol. 1988;68:48-52.
    [Google Scholar]
  22. , , , , , . In vivo imaging of Malassezia yeasts on human skin using confocal laser scanning microscopy. Laser Phys Lett. 2005;2:148-52.
    [Google Scholar]
  23. , , , , , , . New insights on dandruff/seborrhoeic dermatitis: the role of the scalp follicular infundibulum in effective treatment strategies. Br J Dermatol. 2011;165(Suppl 2):18-23.
    [Google Scholar]
  24. , , , , . Increased hair shedding may be associated with the presence of Pityrosporum ovale. Am J Clin Dermatol. 2006;7:263-6.
    [Google Scholar]
  25. , , , , . From axioms to new insights into dandruff. Dermatology. 2000;200:93-8.
    [Google Scholar]
  26. , , , . Revisiting dandruff. Int J Cosmet Sci. 2006;28:311-8.
    [Google Scholar]

Fulltext Views
1,091

PDF downloads
287
View/Download PDF
Download Citations
BibTeX
RIS
Show Sections
Scroll to Top