Translate this page into:
Analysis of beta-lactamases, blaNDM-1 phylogeny & plasmid replicons in multidrug-resistant Klebsiella spp. from a tertiary care centre in south India
Reprint requests: Dr. P. R. Manish Kumar, Department of Biotechnology, University of Calicut, Thenhipalam 673 635, Kerala, India e-mail: manishramakrishnan@rediffmail.com
-
Received: ,
This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.
This article was originally published by Medknow Publications & Media Pvt Ltd and was migrated to Scientific Scholar after the change of Publisher.
Abstract
Background & objectives:
β-lactamases play a predominant role in drug-resistance amongst Enterobacteriaceae. Presence of genes on transferable plasmids encoding these enzymes favours their dissemination across species and genera within and outside geographical boundaries. This study was aimed to understand the presence of β-lactamases and transferable plasmids in clinical isolates of Klebsiella spp. which can contribute to the spread of resistance determinants.
Methods:
A total of 41 clinical isolates of Klebsiella spp., collected from a tertiary care centre in Kerala, India, were checked for antibiotic sensitivity and the presence of plasmids. The ability to produce extended-spectrum β-lactamases (ESBLs) and metallo-β-lactamases (MBLs) was screened for and confirmed in 29 plasmid-harbouring isolates. blaNDM-1-specific primers were used for polymerase chain reaction amplification with plasmid DNA as template to determine episomal prevalence of this gene and its sequence-based phylogeny employing similar sequences from GenBank. Plasmid replicon typing was also carried out to determine the presence of transferable plasmids.
Results:
Our results showed a high degree of multidrug-resistant (MDR) pathogens with ESBL production confirmed in 52 per cent, MBL in 31 per cent and co-production of both enzymes in seven per cent of the plasmid-bearing isolates. Plasmid DNA from 14 per cent of the isolates produced blaNDM-1-specific amplicons which showed sequence homology with those from bacteria of different genera and geographical areas. The predominant replicon type was found to be that of conjugative plasmids belonging to the incompatibility group - IncFIIK.
Interpretation & conclusions:
This study provides insight into the predominance of various β-lactamases and potent gene-disseminating agents in Klebsiella spp. and emphasizes the need for constant surveillance of these pathogens to determine appropriate treatment strategies.
Keywords
blaNDM-1
conjugative plasmids
extended-spectrum β-lactamases – metallo-β-lactamase
multidrug-resistance
replicon-typing
Emergence of multidrug resistant (MDR) Gram-negative bacteria continues to be a major health concern worldwide12. During the past decades, a significant rise has been observed in the dissemination of multidrug and pandrug-resistant Enterobacteriaceae3. Klebsiella spp. represent one of the predominant nosocomial pathogens of this family245. These pathogens are a cause of concern due to their ability to produce various β-lactamases such as extended-spectrum β-lactamases (ESBLs), metallo-β-lactamases (MBLs) and carbapenemases, which make them resistant to even carbapenems with therapeutical options possibly remaining limited mostly to tigecycline and fosfomycin. Hence, adoption of effective treatment strategies and efficient health management becomes increasingly difficult6-8. Amongst the ESBL genes, blaCTX-M15 is the most widespread type reported from Enterobacteriaceae in India9. One of the latest MBLs identified in Gram-negative bacteria10, the blaNDM type carbapenemases, was identified first in India11. Moreover, since the genes encoding these enzymes are frequently disseminated through transferrable plasmids, this has also contributed to a faster spread of resistance across species and genera12. Hence, the alternate name plasmid-encoding carbapenem-resistant MBL has been suggested to be a more appropriate one compared to the earlier controversial designation blaNDM13.
The gene blaNDM has been reported both on narrow host-range plasmids belonging to the incompatibility group IncF, as well as other wide host-range plasmids such as IncA/C, IncL/M, IncH and IncN101415. IncF comprises conjugative, low copy number plasmids capable of multireplicon existence, which facilitate their occurrence in a wide host range. Along with blaNDM, the IncF plasmids frequently carry genes for ESBL of clinical importance such as blaCTX-M1561416. In addition, IncF plasmids are also known to carry genes encoding resistance to aminoglycosides, which confer multidrug resistance to the host organism61415.
In this study, clinical isolates of Klebsiella spp. were screened for ESBL and MBL production. Presence of blaNDM-1 gene on plasmid DNA was determined and the amplicons obtained were checked for maximal homology against sequences in databases reported from elsewhere. A polymerase chain reaction (PCR)-based replicon typing of plasmid DNA was also performed to identify the predominant type of plasmid replicons present in these pathogens.
Material & Methods
The study was conducted in the recombinant DNA laboratory, department of Biotechnology, University of Calicut, Thenhipalam, India. Bacteria originally isolated from clinical sources including urine, catheter tip, pus and sputum, during a two-year period from August 2011 to August 2013, were transported in pure line form to our laboratory from the Microbiology Division of Little Flower Hospital, Angamaly, Ernakulam district, Kerala. A selective sampling was performed, in which bacterial isolates resistant to more than one antibiotic were selected. The sample size of these select clinical isolates was 100 which comprised six genera including species of Klebsiella, Escherichia, Pseudomonas, Acinetobacter, Enterococcus and Staphylococcus. Of these, 41 Klebsiella spp. were subjected to ribotyping, using Klebsiella MTCC3384 as a reference strain, and plasmid isolation by alkaline lysis method17. Only those isolates which were found to harbour plasmid DNA, as evidenced by electrophoretic profiles (n=29), were included in the study.
Antibiotic sensitivity: The sensitivity of the isolates against 11 antibiotics belonging to five different classes was assayed by disc diffusion method18 as per Clinical Laboratory Standards Institute (CLSI) guidelines19. The antibiotic discs (Hi-Media, Mumbai) used in this study were - ampicillin (AMP) - 10 µg, ceftazidime (CAZ) - 30 µg, cefotaxime (CTX) - 30 µg, aztreonam (AT) - 30 µg, piperacillin/tazobactam (PIT) - 100/10 µg, azithromycin (AZM) - 15 µg, gentamicin (GEN) - 10 µg, nalidixic acid (NA) - 30 µg, ciprofloxacin (CIP) - 5 µg, meropenem (MRP) - 10 µg and chloramphenicol (C)-30 µg.
Phenotypic detection of extended-spectrum β- lactamases (ESBL) and metallo-β-lactamase (MBL) production: The ability of the isolates to produce ESBL was detected in accordance with CLSI guidelines19. CTX, CAZ and AT discs were used for ESBL screening and CTX/CAZ-clavulanic acid combination [cefotaxime-clavulanic acid (CEC) and ceftazidime-clavulanic acid (CAC)] were used for ESBL confirmation. MRP and MRP-EDTA discs were used for disc potentiation test to detect MBL production20.
PCR-based screening for blaNDM-1 gene sequences: A PCR-based screening was conducted to detect the presence of blaNDM-1 gene on plasmid DNA from the isolates, using primers NDM-F - 5’GGTTTGGCGATCTGGTTTTC 3’ and NDM-R - 5’CGGAATGGCTCATCACGATC 3’621. The PCR reactions were performed in a MiniCycler™ (MJ Research, USA) in 25 µl reaction volume containing 1x PCR buffer, 1.5 mM MgCl2, 200 µM each of dNTPs, 2 U of Taq DNA polymerase, 0.5 µM of each primer and 100 ng template DNA. All reagents were purchased from Bangalore Genei, India. NDM-F/R primers (HPLC Purified) were obtained from Sigma-Aldrich Chemicals Pvt. Ltd. (Bengaluru). The programming of PCR cycle was as follows: Initial denaturation for 10 min at 94°C followed by 30 cycles of denaturation, annealing and extension at 94°C for one minute, 60°C for one minute and 72°C for two minutes respectively. After 30 cycles, a final extension was carried out for 10 min at 72°C. Amplicons were loaded on one per cent (w/v) agarose gels and the images were captured on an AlphaImager™ 2200 (Alpha Innotech Corporation, USA).
The PCR products were sequenced at a commercial facility (Xcelris Labs Limited, Ahmedabad). The nucleotide sequences and deduced protein sequences were analyzed with BLAST and FASTA programmes of NCBI (www.ncbi.nlm.nih.gov). Presence of ORFs and conserved regions were checked by ORF finder (www.ncbi.nlm.nih.gov/gorf/gorf.html).
Phylogenetic analysis of blaNDM-1 sequences: Phylogenetic analysis was performed with 4 blaNDM-1 sequences obtained in the present study (GenBank Accession numbers KX090027, KX090028, KX090029 and KX090030) and five similar sequences previously reported from different geographical areas showing highest query coverage and maximum identity with our sequence in BLASTN analysis. To determine the nearest phylogenetic neighbours, each sequence was subjected to the nucleotide sequence homology searches using BLAST homology search tool. All the sequences were aligned using default configuration of multiple sequence alignment tool ‘MUSCLE’ embedded in MEGA 5 software (http://www.megasoftware.net). The phylogenetic tree was constructed by neighbour-joining method with 1000 heuristic bootstrap replicates and substitution model as ‘p distance’22.
PCR-based replicon typing of plasmid DNA: Plasmids were typed into various incompatibility groups as described previously23 using PBRT kit purchased from Diatheva, Fano, Italy and the amplicons were analyzed with respect to controls provided according to the manufacturer’s instructions.
Statistical analysis: A significant difference between two proportions was checked by Z-test using Statistica software (Statsoft, India) version 5.0. A two-tailed P<0.01 was considered significant.
Results
Ribotyping of the 41 clinical isolates along with the control strain, Klebsiella MTCC3384, confirmed the isolate identity, as these were found to display similar amplicons with identical molecular weight of 1.3 kb. The sequence identity of the amplicon was confirmed to be 16s ribosomal RNA of Klebsiella spp. by DNA sequencing. Of the 41 isolates, 29 plasmid-bearing isolates, designated as K1 to K29, were subjected to further study.
Antibiotic resistance of the isolates: All isolates were found to be resistant to AMP, β-lactam/β-lactam inhibitor combination - PIT, first- and second-generation quinolones (NA, CIP and AT). Resistance to third- generation cephalosporins (CTX and CAZ) and AZM was also found to be high with 96.5 per cent of the isolates showing resistant phenotype. However, comparatively decreased resistance was observed in isolates against GEN (86%), MRP (79%) and C (76%). The antibiotic resistance phenotype of each of the 29 plasmid-bearing isolates is given in Table I.
ESBL and MBL production: ESBL production was confirmed in 15 of the 29 plasmid-bearing isolates (52%) as per CLSI (2014) criteria – (i) zone of inhibition ≤22, ≤27 and ≤27 mm for CAZ, AT and CTX, respectively, and (ii) a>5 mm enhancement in the zone of inhibition around clavulanic acid-containing discs. The latter criterion was observed only with CAC but not with CEC discs. Only nine isolates (31%) were found to produce MBL as evidenced by a >7 mm enhanced zone of inhibition around EDTA-containing discs. Two isolates (7%) co-produced both ESBL and MBL.
Phylogenetic analysis of blaNDM-1 gene sequences: Plasmid DNA from the isolates was employed as template for amplification by PCR using blaNDM-1- specific primers. Amplicons were observed in only four (14%) (Table I) isolates which were found to vary in size from 580 to 605 bp (Fig. 1). The DNA sequence identity was confirmed using BLASTN analysis. These four DNA sequences together with five other similar sequences, retrieved from NCBI Genbank database, based on the criteria mentioned above, were used to construct the phylogenetic tree to understand the nearest neighbour of the study sequences. The genetic divergence and homogeneity of the sequences are apparent in the phylogenetic tree (Fig. 2). Amongst the DNA sequences obtained from our study, those from isolates K1 and K28 were found to form distinct lineages, while those from K27 and K13 shared similarity and were found to be closely related to the sequences reported earlier from Tamil Nadu (Accession no. 817735963) and New Delhi (Accession no. 749446381 and 749446385). Interestingly, the two sequences reported from Korea (Accession no. 937297641) and Japan (Accession no. KP347609.1) fell under a separate clade, and their genetic similarity with other sequences was also clearly discernible in the phylogenetic tree.


PCR-based replicon typing of plasmid DNA: Of the 29 plasmid-bearing isolates, plasmids from 22 isolates were typed, by PCR, into ten different incompatibility groups, namely, IncFIA, IncFIB-M, IncFII, IncFIIK, IncFIIS, IncHIB-M, IncA/C, IncX2, IncK and IncR (Fig. 3A). The remaining isolates failed to produce a specific amplicon. All the replicons, except IncX2, were found to exist as a combination of different replicons perhaps due to the presence of multiple plasmids in a cell or occurrence of more than one replicon on individual plasmids. IncFIIK was found to be the most prevalent one followed by IncR (Fig. 3B). Of the 10 IncR plasmids obtained, nine were found to coexist with IncFIIK (P=0.0003) and one with IncFIA. The next predominant replicon type, IncX2, was found to exist both as a single replicon (50%) as well as a multireplicon plasmid (50%) (Table II). All of the IncX2 harbouring isolates were found to be resistant to MRP with 87.5 per cent resistant to all antibiotics tested (P=0.002). Likewise, 90 per cent of the IncR-bearing isolates were found to be resistant to MRP and AZM (P=0.0003). IncFIA was found to coexist either with IncR (17%) or with IncFIIK alone (33%) or in combination with IncR and IncFIIK (50%). Three isolates were found to share an association of IncR, IncFIIK, IncHIB-M and IncFIB-M replicons (Table II), two of which, K1 and K12, co-produced ESBL and MBL.

Discussion
β-lactam antibiotics are currently in use for treating infections with Enterobacteriaceae including Klebsiella spp., in which β-lactam resistance is mainly mediated by production of β-lactamases such as AmpC β-lactamases, ESBLs, MBL and other carbapenemases. MDR bacteria producing each individual type of β-lactamase alone or in combination continue to emerge as a worrisome challenge for antimicrobial therapy924. Occurrence of ESBL and MBL producers observed in this study and the observation of co-production of these two enzymes by two isolates was in agreement with the findings of the above-mentioned studies. ESBL producers are reported to be often resistant to multiple antibiotics1624. In our study also 60 per cent of the isolates were found to be resistant to all of the antibiotics tested.
Following its first identification from India11, blaNDM-1-producing Gram-negative bacteria have become a worrisome issue in the clinical field925. In our study, blaNDM-1 gene was amplified from plasmid DNA of four isolates (14%). Although these four DNA sequences exhibited individual distinctness, they also shared similarities. Close relatives of the sequences obtained in the present study were found to be those reported from two other States in India - Tamil Nadu and New Delhi, in earlier studies (Accession nos. gi|817735963, gi|749446381 and gi|749446385). Homology was also evident with the sequences deposited from other countries – Korea26 and Japan27 (Accession nos. gi|937297641, gb|KP347609.1). Further studies are required to unravel the clinical implications of these plasmid harbouring strains. Widespread dissemination of pathogens carrying antibiotic resistance genes breaching geographical boundaries due to increased human mobility undoubtedly play a pivotal role contributing to such a situation1228.
In this study, IncFIIK plasmids were prevalent followed by that belonging to the IncR group. Up to 90 per cent of the IncR plasmids were found to coexist with IncFIIK. This situation is capable of imparting wide host range and self-transferring capacity to these plasmids if existing in a multireplicon state, in spite of the immobility of IncR29 and narrow host range of IncF plasmids. Moreover, all of the IncF type plasmids, namely, IncFIA, IncFIB-M, IncFII, IncFIIS and IncFIIK observed in this study were found to exist as part of multireplicon plasmids which affirms observations reported earlier23. A prominent feature of IncX2-bearing isolates noticed in this study was resistance shown by 87.5 per cent isolates against all antibiotics tested, and the enhanced resistance to MRP observed amongst IncR-bearing isolates was in agreement with the earlier reports on these plasmid-borne resistance genes2930. Bonnin et al10, speculated that IncFII, plasmid replicons endemic to Indian subcontinent, might play a major role in the dissemination of blaNDM gene. This narrow host range, multireplicon plasmid, was also reported to be a frequent carrier of ESBLs, especially blaCTX-M14162331. Interestingly, the prevalent plasmid in blaNDM-1-producing isolates in this region was also found to be a variant of IncFII, IncFIIK. Interestingly, the fact that these plasmids have been associated with several addiction systems102332, combined with the unique feature of blaNDM-1 gene’s presence on plasmids, ensures stable maintenance of this MBL gene during host replication.
In conclusion, our findings showed a normal β-lactamase production and a higher occurrence of IncFIIK type plasmid replicons in MDR Klebsiella spp. from Kerala compared to similar investigations571631. The same replicon was also found to be the predominant one amongst blaNDM-1-carrying isolates of this species. The observation of the coexistence of IncFIIK with wide host-range replicons of IncR type and phylogenetic studies of blaNDM-1 sequences provide indication of the challenging situation of horizontal gene transfer occurring amongst these potential pathogens. This study mainly showcases the threats to healthcare in a major tertiary care centre in Kerala. However, this limitation can be overcome by conducting elaborate and detailed molecular investigations on a larger scale to better understand the current scenario of pathogenic bacterial drug resistance in the country.
Acknowledgment
This work was supported by an ICMR grant to NN as JRF and SRF.
Conflicts of Interest: None.
References
- Facing the challenge of multidrug-resistant Gram-negative bacilli in Australia. Med J Aust. 2015;202:243-7.
- [Google Scholar]
- Multidrug-resistant Gram-negative bacteria: A product of globalization. J Hosp Infect. 2015;89:241-7.
- [Google Scholar]
- Multidrug-resistant and extensively drug-resistant Gram-negative pathogens: Current and emerging therapeutic approaches. Expert Opin Pharmacother. 2014;15:1351-70.
- [Google Scholar]
- Prevalence of antimicrobial drug resistance of Klebsiella pneumoniae in India. Int J Biosci Biochem Bioinforma. 2011;1:211.
- [Google Scholar]
- A ten year analysis of multi-drug resistant blood stream infections caused by Escherichia coli and Klebsiella pneumoniae in a tertiary care hospital. Indian J Med Res. 2012;135:907.
- [Google Scholar]
- Genetic features of blaNDM-1-positive Enterobacteriaceae. Antimicrob Agents Chemother. 2011;55:5403-7.
- [Google Scholar]
- ESBL, MBL and Ampc b lactamases producing superbugs –Havoc in the Intensive Care Units of Punjab India. J Clin Diagn Res. 2013;7:70-3.
- [Google Scholar]
- Treating infections caused by carbapenemase-producing Enterobacteriaceae. Clin Microbiol Infect. 2014;20:862-72.
- [Google Scholar]
- Surveillance for antimicrobial drug resistance in under-resourced countries. Emerg Infect Dis. 2014;20:434-41.
- [Google Scholar]
- Characterization of an IncFII plasmid encoding NDM-1 from Escherichia coli ST131. PLoS One. 2012;7:e34752.
- [Google Scholar]
- Characterization of a new metallo-β-lactamase gene blaNDM-1 and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53:5046-54.
- [Google Scholar]
- New Delhi metallo-beta-lactamase (NDM-1): Towards a new pandemia? Clin Microbiol Infect. 2010;16:1699-701.
- [Google Scholar]
- Science, names giving and names calling: Change NDM-1 to PCM. Mens Sana Monogr. 2011;9:294-319.
- [Google Scholar]
- Replicon sequence typing of IncF plasmids carrying virulence and resistance determinants. J Antimicrob Chemother. 2010;65:2518-29.
- [Google Scholar]
- New Delhi metallo-b-lactamase-producing Enterobacteriaceae United States. Emerg Infect Dis. 2013;19:870-8.
- [Google Scholar]
- Prevalence of IncI1-Iγand IncFIA-FIB type plasmids in extended-spectrum ß-lactamase-producing Klebsiella pneumoniae strains isolated from the NICU of a North Indian hospital. Microbiology. 2014;160(Pt 6):1153-61.
- [Google Scholar]
- Molecular cloning: A laboratory manual (2nd ed). New York: Cold Spring Harbor Laboratory Press; 1989.
- Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966;45:493-6.
- [Google Scholar]
- Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement M100-S24. Wayne, PA: CLSI; 2014.
- Metallo beta lactamase producing Pseudomonas aeruginosa and Acinetobacter baumannii. Indian J Med Microbiol. 2011;29:302-4.
- [Google Scholar]
- Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70:119-23.
- [Google Scholar]
- The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406-25.
- [Google Scholar]
- Resistance plasmid families in Enterobacteriaceae. Antimicrob Agents Chemother. 2009;53:2227-38.
- [Google Scholar]
- Occurrence of various beta-lactamase enzyme-producing Enterobacteriaceae in the hospital effluent: A wake-up call. Int J Med Sci Public Health. 2016;5:1204-8.
- [Google Scholar]
- Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: A molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10:597-602.
- [Google Scholar]
- Complete genome sequence of Klebsiella pneumoniae subsp. pneumoniae KP617, coproducing OXA-232 and NDM-1 carbapenemases, isolated in South Korea. Genome Announc. 2016;4:e01550-15.
- [Google Scholar]
- High prevalence of blaOXA-23 in Acinetobacter spp. and detection of blaNDM-1 in A. soli in Cuba: Report from National Surveillance Program (2010-2012) New Microbes New Infect. 2015;7:52-6.
- [Google Scholar]
- Antibiotic resistance: Implications for global health and novel intervention strategies: Workshop summary. Washington, DC: National Academies Press; 2010.
- Complete nucleotide sequence of two multidrug-resistant IncR plasmids from Klebsiella pneumoniae. Antimicrob Agents Chemother. 2014;58:4207-10.
- [Google Scholar]
- Identification and characterization of a novel incompatibility group X3 plasmid carrying blaNDM-1 in Enterobacteriaceae isolates with epidemiological links to multiple geographical areas in China. Emerg Microbes Infect. 2012;1:e39.
- [Google Scholar]
- Multiclonal dispersal of KPC genes following the emergence of non-ST258 KPC-producing Klebsiella pneumoniae clones in Madrid, Spain. J Antimicrob Chemother. 2013;68:2487-92.
- [Google Scholar]
- Molecular characterization of CTX-M b-lactamase and associated addiction systems in Escherichia coli circulating among cattle, farm workers, and the farm environment. Appl Environ Microbiol. 2013;79:3898-905.
- [Google Scholar]
