Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Addendum
Announcement
Announcements
Author’ response
Author’s reply
Authors' response
Authors#x2019; response
Book Received
Book Review
Book Reviews
Books Received
Centenary Review Article
Clinical Image
Clinical Images
Commentary
Communicable Diseases - Original Articles
Correspondence
Correspondence, Letter to Editor
Correspondences
Correspondences & Authors’ Responses
Corrigendum
Corrrespondence
Critique
Current Issue
Editorial
Editorial Podcast
Errata
Erratum
FORM IV
GUIDELINES
Health Technology Innovation
IAA CONSENSUS DOCUMENT
Innovations
Letter to Editor
Malnutrition & Other Health Issues - Original Articles
Media & News
Notice of Retraction
Obituary
Original Article
Original Articles
Panel of Reviewers (2006)
Panel of Reviewers (2007)
Panel of Reviewers (2009) Guidelines for Contributors
Perspective
Policy
Policy Document
Policy Guidelines
Policy, Review Article
Policy: Correspondence
Policy: Editorial
Policy: Mapping Review
Policy: Original Article
Policy: Perspective
Policy: Process Paper
Policy: Scoping Review
Policy: Special Report
Policy: Systematic Review
Policy: Viewpoint
Practice
Practice: Authors’ response
Practice: Book Review
Practice: Clinical Image
Practice: Commentary
Practice: Correspondence
Practice: Letter to Editor
Practice: Method
Practice: Obituary
Practice: Original Article
Practice: Pages From History of Medicine
Practice: Perspective
Practice: Review Article
Practice: Short Note
Practice: Short Paper
Practice: Special Report
Practice: Student IJMR
Practice: Systematic Review
Pratice, Original Article
Pratice, Review Article
Pratice, Short Paper
Programme
Programme, Correspondence, Letter to Editor
Programme: Authors’ response
Programme: Commentary
Programme: Correspondence
Programme: Editorial
Programme: Original Article
Programme: Originial Article
Programme: Perspective
Programme: Rapid Review
Programme: Review Article
Programme: Short Paper
Programme: Special Report
Programme: Status Paper
Programme: Systematic Review
Programme: Viewpoint
Protocol
Public Notice
Research Brief
Research Correspondence
Retraction
Review Article
Reviewers
Short Paper
Some Forthcoming Scientific Events
Special Article
Special Opinion Paper
Special Report
Special Section Nutrition & Food Security
Status Paper
Status Report
Strategy
Student IJMR
Systematic Article
Systematic Review
Systematic Review & Meta-Analysis
View Point
Viewpoint
White Paper
View/Download PDF

Translate this page into:

Original Article
139 (
3
); 463-467

A cfr-positive clinical staphylococcal isolate from India with multiple mechanisms of linezolid-resistance

Department of Studies in Microbiology, University of Mysore, Mysore, India
Department of Microbiology, JSS Medical College, JSS University, Mysore, India

Reprint requests: Dr Shubha Gopal, Department of Studies in Microbiology, University of Mysore, Mysore 570 006, India e-mail: shubhagopal_mysore@yahoo.com

Licence

This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Disclaimer:
This article was originally published by Medknow Publications & Media Pvt Ltd and was migrated to Scientific Scholar after the change of Publisher.

Abstract

Background & objectives:

Linezolid, a member of the oxazolidinone class of antibiotics, has been an effective therapeutic option to treat severe infections caused by multidrug resistant Gram positive bacteria. Emergence of linezolid resistant clinical strains is a serious issue in the healthcare settings worldwide. We report here the molecular characterization of a linezolid resistant clinical isolate of Staphylococcus haemolyticus from India.

Methods:

The species of the clinical isolate was identified by 16S rRNA gene sequencing. The minimum inhibitory concentrations (MICs) of linezolid, clindamycin, chloramphenicol and oxacillin were determined by E-test method. To elucidate the mechanism of linezolid-resistance, presence of cfr gene (chloramphenicol florfenicol resistance) and mutations in 23S rRNA and ribosomal proteins (L3, L4 and L22) were investigated. Staphylococcal Cassette Chromosome mec (SCCmec) typing was performed by multiplex PCR.

Results:

The study documented a rare clinical S. haemolyticus strain with three independent mechanisms of linezolid-resistance. The strain carried cfr gene, the only known transmissible mechanism of linezolid-resistance. The strain also possessed resistance-conferring mutations such as G2576T in domain V of 23S rRNA gene and Met156Thr in L3 ribosomal protein. The other ribosomal proteins (L4 and L22) did not exhibit mutations accountable for linezolid-resistance. Restriction digestion by NheI revealed that all the alleles of 23S rRNA gene were mutated. The isolate showed elevated MIC values (>256 μg ml-1 of linezolid, clindamycin, chloramphenicol and oxacillin. Methicillin resistance was conferred by type I SCCmec element. The strain also harboured lsa(B) gene which encodes an ABC transporter that can efflux clindamycin.

Interpretation & conclusions:

The present study reports the first clinical strain from India with transmissible and multiple mechanisms of linezolid-resistance. Judicious use of linezolid in clinical practice and proper surveillance of cfr-positive strains are of utmost importance to safeguard the efficacy of linezolid.

Keywords

cfr gene
linezolid
mutations
ribosomal proteins

Linezolid is a synthetic drug and the only oxazolidinone antibiotic licensed for clinical use. It is widely used to treat severe infections in adults caused by various drug resistant Gram positive bacteria such as streptococci, methicillin resistant staphylococci and vancomycin resistant enterococci. Although rare (<1% in Staphylococcus aureus, and <2% in coagulase negative staphylococci), linezolid resistance is currently on the rise and emergence of bacterial strains with multiple mechanisms of linezolid-resistance is a cause of concern in antimicrobial chemotherapy1. The first linezolid resistant clinical strain appeared in 2001, a year after the introduction of linezolid as a drug with unique mechanism of action2. Linezolid remains efficient in treating complicated cases of bacteremia, endocarditis, osteomyelitis, nosocomial pneumonia and severe soft tissue infections3. This bacteriostatic antibiotic blocks protein synthesis by interfering the positioning of A-site tRNA in the peptidyl transferase centre of 23S rRNA. Resistance to linezolid is primarily caused by mutations in the domain V of 23S rRNA gene, mutations in the ribosomal proteins L3, L4 and L22 or methylation at C-8 position of A2503 of the 23S rRNA by a methyl transferase encoded by the gene cfr (chloramphenicol florfenicol resistance)4. Co-occurrence of cfr-mediated resistance and mutational resistance has also been documented1. The low occurrence of linezolid resistance is mainly attributed to the absolute synthetic nature of this antibiotic for which natural resistance genes are not widely distributed. Moreover, the presence of multiple copies of 23S rRNA gene in majority of the bacteria (5-6 alleles in staphylococci) reduces the probability of mutational resistance5. Resistance mediated by cfr gene is of great concern as it is usually plasmid or transposon borne and can be disseminated to susceptible population6. cfr also encodes resistance to a group of chemically distinct antibiotics: phenicols, lincosamides, pleuromutilins and streptogramin A7. There have been a few reports of linezolid resistant staphylococci from India8910. But so far no work has been done on the molecular analysis of the isolates from this geographical area.

We undertook this study to investigate the mechanism of resistance in a linezolid resistant clinical isolate of S. haemolyticus.

Material & Methods

The isolate was obtained from a 60 yr old male who was admitted in JSS Medical College, a tertiary care hospital in Mysore, India, following oedema and cellulitis of left lower limb. The patient had been undergoing dialysis in another hospital for the past six months. During the course of dialysis, he had received oral linezolid therapy (600 mg twice daily for a period of 28 days) for methicillin-resistant S. aureus (MRSA) bacteremia. He had hypertension and type II diabetes. His great toe had already been amputed. The patient presented with an open sore and redness in the infected area with pus filled bumps. The swab from the lesion was inoculated on 5 per cent sheep blood agar and MacConkey agar plates and colony was subjected to Gram staining. The culture was further inoculated onto Mannitol Salt Agar (MSA) and DNase plates (Hi-Media, India). Tube coagulase test was also performed using rabbit plasma (Hi-media, Mumbai, India). A second swab from the same site was taken on the following day for confirmation of the pathogen and also to rule out any nosocomial contamination of the wound.

Antimicrobial susceptibility test was performed by Kirby-Bauer disc diffusion method on Mueller Hinton Agar (MHA) plates according to Clinical and Laboratory Standards Institute (CLSI) guidelines11. Minimum inhibitory concentrations (MICs) of linezolid, clindamycin and chloramphenicol were determined by using E-test strips (Biomerieux SA, France) on MHA plates incubated at 37 °C for 24 h. For determining oxacillin MIC, the medium was supplemented with 2 per cent NaCl for the expression of mecA gene and incubated at 35 °C for 24 h.

The genomic DNA was isolated using phenol-chloroform extraction method12 with the addition of lysostaphin (Sigma-aldrich, USA) to a final concentration of 15 μg/ml. The species was identified by 16S rRNA gene sequence analysis13. Staphylococcal Cassette Chromosome mec (SCCmec) typing of the isolate was performed by multiplex PCR using 10 sets of primers in different concentrations as described by Milheirico et al14. Amplification was performed using Accuprime Taq DNA polymerase system (Invitrogen, USA) with the following PCR conditions: denaturation at 95 °C for 15 min followed by 35 cycles of 95 °C for 25 sec, 53 °C for 30 sec and 72 °C for 1 min; and a final extension at 72 °C for 7 min. The prototype strains used as controls for typing were S. aureus COL (type I), S. aureus BK2464 (type II), S. aureus ANS46 (type III), S. aureus MW2 (type IV), S. aureus WIS (type V) and S. aureus HDE288 (type VI)14. To elucidate the mechanism of linezolid resistance, screening for cfr gene was performed using primers described by Kehrenberg and colleagues15. Point mutation in domain V of 23S rRNA gene was investigated by amplifying the locus using primers and PCR conditions described by Meka et al16. The sequence was aligned with the Escherichia coli reference strain (GenBank accession No. V00331) as well as the linezolid susceptible S. haemolyticus strain JCSC1435 (GenBank accession No. AP006716). The amplified fragment was digested with NheI (New England Biolab, UK) using conditions given by the manufacturer to find out the number of alleles of 23S rRNA gene with G2576T mutation. The target site mutations were also investigated in ribosomal proteins L3 (rplC), L4 (rplD) and L22 (rplV) by amplifying the respective loci. rplC and rplV genes were amplified using the primers and PCR conditions described by Mendes et al17. The rplD gene was amplified using primers 5’TATCCGAGCACCTCCTCAAC3’ and 5’ACGGAACTAAATCAGGTTCA 30′ (Deshpande LM, personal communication, November 21, 2012). The optimal cycling conditions for all the rpl loci were the following: 95 °C for 5 min; 35 cycles of 94 °C for 30 sec, 50 °C for 30 sec, and 72 °C for 1 min; and a final extension at 72 °C for 7 min. All the amplicons were sequenced on both stands. Translated nucleotide sequences of rplC, rplD and rplV genes were aligned with the corresponding L3, L4 and L22 proteins of S. haemolyticus strain JCSC1435 (GenBank accession numbers- L3: BAE04111, L4: BAE04112 and L22: BAE04116). As the isolate showed the unusual pattern of lincosamide resistance and macrolide sensitivity (LR/MS), mechanisms by which lincosamide alone is inactivated/effluxed were also investigated. For this, presence of genes which inactivate lincosamide [lnu(A), lnu(B), lnu(C) and lnu(D)] and genes which mediate efflux of the drug [vga(A), vga(B), vga(C), vga(E) and lsa(B)] were checked using primers and PCR conditions described by Lozano et al18.

All the nucleotide sequences from this study have been submitted to GenBank database under the accession numbers KC544271-KC544273, KC572114, KC736551, KC736552 and KC809978.

Results & Discussion

The pathogen was identified as Staphylococcus based on the characteristic growth on blood agar followed by microscopic observation. The isolate showed negative results for mannitol fermentation, DNase and tube coagulase tests, thus confirming coagulase negative Staphylococcus. The 16S rRNA gene sequence revealed the isolate as S. haemolyticus and showed 99 per cent similarity with S. haemolyticus strain JCSC1435 in BLAST search. The strain was resistant to penicillin, cefoxitin, gentamicin, clindamycin, trimethoprim-sulphamethoxazole, rifampicin, chloramphenicol and linezolid. Susceptibility was recorded for the following antibiotics: erythromycin, tetracycline, levofloxacin, quinupristin-dalfopristin and teicoplanin. The isolate showed high MIC values (>256 μg/ml) of linezolid, clindamycin, chloramphenicol and oxacillin. The SCCmec element present in the isolate was found to be of type I, as evidenced by the presence of CIF locus in the cassette. The prototype strain for type I (S. aureus COL) worked as the positive control. cfr gene was detected and confirmed by sequencing the amplicon on both strands. This is perhaps the first report of a cfr-carrying clinical isolate from India. Recently Cui et al19 and Cai et al20 have described cfr carrying S. haemolyticus strains from clinical samples.

The BLAST alignment revealed G2576T (E.coli numbering) mutation in the domain V of 23S rRNA gene. This is the most frequent mutation in linezolid resistant strains and it has been previously reported in S. haemolyticus212223. The mutation was confirmed by the restriction digestion of the 420 bp amplicon by NheI which can detect this transverion. Agarose gel pattern revealed new fragments of sizes 322 and 98 bp which indicated the presence of G2576T mutation. Moreover, the complete digestion of the PCR products with NheI indicated that all the five alleles of 23S rRNA gene were mutated.

The blastx analysis of rplC gene which codes for L3 protein, revealed Met156Thr mutation. This substitution mutation has previously been reported in a few linezolid resistant S. epidermidis strains24. Until recently this mutation was not reported in the context of linezolid resistance in S. haemolyticus25. In L4 protein, no mutation was detected in the highly conserved region (63KPWK/RQKGTGRAR74), which is usually implicated in oxazolidinone resistance. The isolate did not possess any mutation in L22 ribosomal protein, and was negative for the tested lnu and vga genes. Only lsa(B) gene which encodes an ABC transporter was detected and confirmed by sequencing.

S. haemolyticus has emerged as a nosocomial pathogen on account of its ability to attain high level resistance to many antibiotics including glycopeptides26. Linezolid resistance in S. haemolyticus is considered rare; however, there have been recent reports from India, China, Brazil, Italy and Spain81920212223. In the present study, the ribosomal mutations in the isolate might have occurred under antibiotic pressure as the patient had undergone linezolid therapy. Moreover, the long-term linezolid usage by the patient could be the reason for G2576T mutations in all the copies of 23S rRNA gene. Previous in vivo studies have established a positive correlation between the number of rRNA alleles mutated and the dosage and duration of linezolid therapy27. M156T mutation and mutations in adjacent amino acids (V154L, G155R, A157R, S158F and D159Y) have been implicated in linezolid resistance owing to their proximity to the binding cleft of linezolid in L3 protein4. In the present study, the elevated MIC (>256 μg/ml) of linezolid can be attributed to the simultaneous occurrence of all the three mechanisms of resistance. More worrisome is the presence of cfr gene in the isolate, as its low fitness cost would enable the cells to retain it even in the absence of selection pressure imposed by the antibiotic. cfr is usually located in an unstable genetic environment either on the chromosome or on multidrug resistant plasmids28. This would facilitate the easy spread of cfr into susceptible population and other pathogenic bacteria. Furthermore, cfr-mediated resistance limits therapeutic options as it encodes resistance to an array of antibiotics.

In conclusion, the study emphasizes the need for proper surveillance of cfr-carrying strains in the healthcare settings in India. Linezolid resistant strains which exhibit the unusual pattern of erythromycin-sensitivity and clindamycin-resistance could be suspected for the presence of cfr gene. cfr can also be selected under the pressure imposed by other classes of antibiotics such as phenicols, lincosamides, pleuromutilins and Streptogramin A. Judicious use of these antibiotics and stringent infection control measures are important to prevent the spread of cfr-carrying strains in nosocomial environment.

Acknowledgment

The authors thank Dr Wilma Ziebuhr, Institute for Molecular Infection Biology, University of Wuerzburg, Germany, for the SCCmec prototype strains. The first author (VR) acknowledges the Department of Science and Technology, New Delhi, India for DST-INSPIRE Fellowship.

References

  1. , , , , , , . Worrisome trend of new multiple mechanisms of linezolid resistant in staphylococcal clones diffused in Italy. J Clin Microbiol. 2013;51:1256-9.
    [Google Scholar]
  2. , , , , , , . Linezolid resistance in a clinical isolate of Staphylococcus aureus. Lancet. 2001;358:207-8.
    [Google Scholar]
  3. , , , , . Linezolid resistance in staphylococci. Pharmaceuticals. 2010;3:1988-2006.
    [Google Scholar]
  4. , , . Resistance to linezolid caused by modifications at its binding site on the ribosome. Antimicrob Agents Chemother. 2012;56:603-12.
    [Google Scholar]
  5. , , , , , , . Resistance to linezolid: characterization of mutations in rRNA and comparison of their occurrences in vancomycin-resistant enterococci. Antimicrob Agents Chemother. 2001;45:2154-6.
    [Google Scholar]
  6. , , , . IS 21-558 insertion sequences are involved in the mobility of the multiresistance gene cfr. Antimicrob Agents Chemother. 2007;51:483-7.
    [Google Scholar]
  7. , , , , , . The cfr rRNA methyltransferase confers resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A antibiotics. Antimicrob Agents Chemother. 2006;50:2500-5.
    [Google Scholar]
  8. , , , . Linezolid resistant staphylococcus sp. at a tertiary care hospital of Andhra Pradesh. Indian J Med Microbiol. 2011;29:314-5.
    [Google Scholar]
  9. , , , , , , . Sepsis due to linezolid resistant Staphylococcus cohnii and Staphylococcus kloosii: First reports of linezolid resistance in coagulase negative staphylococci from India. Indian J Med Microbiol. 2011;29:60-2.
    [Google Scholar]
  10. , , , , , . Linezolid resistant Staphylococcus haemolyticus: first case report from India. Asian Pac J Trop Med. 2012;5:837-8.
    [Google Scholar]
  11. Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing; Twenty Second Informational Supplement. M100-S22. Wayne, PA: CLSI; .
    [Google Scholar]
  12. , , . Molecular cloning: A laboratory manual. (3rd ed). New York: Cold Spring Harbor Laboratory Press; .
    [Google Scholar]
  13. , . 16S/23S rRNA sequencing. In: , , eds. Nucleic acids techniques in bacterial systematics. New York: John Wiley; . p. :115-75.
    [Google Scholar]
  14. , , , . Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother. 2007;51:3374-7.
    [Google Scholar]
  15. , , , , , . A new mechanism for chloramphenicol, florfenicol and clindamycin resistance: methylation of 23S ribosomal RNA at A2503. Mol Microbiol. 2005;57:1064-73.
    [Google Scholar]
  16. , , , , , , . Linezolid resistance in sequential Staphylococcus aureus isolates associated with a T2500A mutation in the 23S rRNA gene and loss of a single copy of rRNA. J Infect Dis. 2004;190:311-7.
    [Google Scholar]
  17. , , , , , , . Assessment of linezolid resistance mechanisms among Staphylococcus epidermidis causing bacteraemia in Rome, Italy. J Antimicrob Chemother. 2010;65:2329-35.
    [Google Scholar]
  18. , , , , , , . Genetic environment and location of the lnu(A) and lnu(B) genes in methicillin resistant Staphylococcus aureus and other staphylococci of animal origin. J Antimicrob Chemother. 2012;67:2804-8.
    [Google Scholar]
  19. , , , , , , . Cfr-mediated linezolid resistance among methicillin-resistant coagulase-negative staphylococci from infections of humans. PLoS One. 2013;8:e57096.
    [Google Scholar]
  20. , , , , , . Linezolid-resistant clinical isolates of meticillin resistant coagulase negative staphylococci and Enterococcus faecium from China. J Med Microbiol. 2012;61:1568-73.
    [Google Scholar]
  21. , , , , . Clonal dissemination of linezolid-resistant Staphylococcus haemolyticus exhibiting the G2576T mutation in the 23S rRNA gene in a tertiary care hospital in Brazil. Antimicrob Agents Chemother. 2012;56:2792-93.
    [Google Scholar]
  22. , , , , , , . Outbreak of linezolid-resistant Staphylococcus haemolyticus in an Italian intensive care unit. Eur J Clin Microbiol Infect Dis. 2012;31:523-7.
    [Google Scholar]
  23. , , , , , , . Nosocomial spread of linezolid resistant Staphylococcus haemolyticus infections in an intensive care unit. Diagn Microbiol Infect Dis. 2009;63:398-402.
    [Google Scholar]
  24. , , , , , . Molecular and epidemiologic characteristics of linezolid resistant coagulase-negative staphylococci at a tertiary care hospital. Diagn Microbiol Infect Dis. 2010;68:34-9.
    [Google Scholar]
  25. , , , , , . An international activity and spectrum analysis of linezolid: ZAAPS program results for 2011. Diagn Microbiol Infect Dis. 2013;76:206-13.
    [Google Scholar]
  26. , , , , , . Teicoplanin use and emergence of Staphylococcus haemolyticus: is there a link? Clin Microbiol Infect. 2006;12:96-7.
    [Google Scholar]
  27. , , , , , , . Dose dependence of emergence of resistance to linezolid in Enterococcus faecalis in vivo. J Infect Dis. 2007;195:1480-8.
    [Google Scholar]
  28. , , , , , . Transferable multidrug resistance plasmid carrying cfr associated with tet(L), ant (4’)-Ia, and dfrK genes from a clinical methicillin resistant Staphylococcus aureus ST125 strain. Antimicrob Agents Chemother. 2012;56:2139-42.
    [Google Scholar]
Show Sections
Scroll to Top